ID: 931011135

View in Genome Browser
Species Human (GRCh38)
Location 2:57915732-57915754
Sequence TGGTCTGCAGCCCAGCGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 1, 2: 11, 3: 59, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931011135_931011146 29 Left 931011135 2:57915732-57915754 CCAACCCGCTGGGCTGCAGACCA 0: 1
1: 1
2: 11
3: 59
4: 283
Right 931011146 2:57915784-57915806 GAAACACAGCAAGAAGTGAGTGG 0: 1
1: 0
2: 6
3: 110
4: 1000
931011135_931011141 0 Left 931011135 2:57915732-57915754 CCAACCCGCTGGGCTGCAGACCA 0: 1
1: 1
2: 11
3: 59
4: 283
Right 931011141 2:57915755-57915777 GTACCGGTTTGTGGCCTGTTAGG 0: 4
1: 51
2: 415
3: 787
4: 1183
931011135_931011139 -9 Left 931011135 2:57915732-57915754 CCAACCCGCTGGGCTGCAGACCA 0: 1
1: 1
2: 11
3: 59
4: 283
Right 931011139 2:57915746-57915768 TGCAGACCAGTACCGGTTTGTGG 0: 1
1: 1
2: 17
3: 73
4: 229
931011135_931011143 7 Left 931011135 2:57915732-57915754 CCAACCCGCTGGGCTGCAGACCA 0: 1
1: 1
2: 11
3: 59
4: 283
Right 931011143 2:57915762-57915784 TTTGTGGCCTGTTAGGAACCAGG 0: 26
1: 303
2: 767
3: 1138
4: 1271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931011135 Original CRISPR TGGTCTGCAGCCCAGCGGGT TGG (reversed) Intronic
900601431 1:3504414-3504436 TGGTCTGAGGCTCAGCGGGATGG - Intronic
901557783 1:10045232-10045254 TGGTCTGTGGCCCAGGGGTTGGG + Intronic
902385130 1:16072068-16072090 AGGCCTGCAGCCTAGCGGGAGGG - Intronic
903369297 1:22824945-22824967 TCCTCTGCAGCCCTGCGGGAAGG + Intronic
904294687 1:29511696-29511718 CGGTCTGCAGCCCAGGGGTTGGG + Intergenic
904498875 1:30902684-30902706 TGGACTACAGCCCAGCTGCTTGG - Intronic
905308062 1:37032806-37032828 CGGTCAGAAACCCAGCGGGTGGG - Intronic
905857123 1:41321511-41321533 TGGTCAGCAGCCCAGGGTGGGGG + Intergenic
907155579 1:52330770-52330792 TGGGCTGCATCCCAGGAGGTTGG - Intronic
907409391 1:54273911-54273933 TGGCCTGGAGCCCAGCAGTTGGG + Intronic
907517593 1:55002434-55002456 TGGTCTCCAGCACAGCAGGCAGG - Intronic
908172174 1:61516271-61516293 TGGTCTGCGGCCTAGGGGTTGGG - Intergenic
908611728 1:65868657-65868679 TGGTCTGCAGCCTGGGGGTTGGG - Intronic
912062557 1:105690804-105690826 TGGTCTGCAGCCCAGGGAATGGG - Intergenic
912339285 1:108895435-108895457 TGGTCTGTGGCCCAGGGGTTGGG - Intronic
914760359 1:150593654-150593676 TGGTCTGCAGCCCAGGGTTTGGG + Intergenic
914960714 1:152204089-152204111 TAGTCTGTAGCCCAGGGGTTGGG + Intergenic
915737040 1:158091573-158091595 TGCTCTGCACCCCAGCTGGCAGG - Intronic
916739811 1:167638126-167638148 TGGTGGGCAGCCCAGCAGGGTGG - Intronic
916820503 1:168393552-168393574 TGGTCTGAAGCCCTGCTGTTAGG + Intergenic
917098956 1:171426812-171426834 TGGTCTGCAGCTCGGGGGTTGGG + Intergenic
917203416 1:172542433-172542455 TGGTCCGCAGCCCAGGGGCTGGG - Intronic
917995879 1:180437955-180437977 TGGCCTGCAGCCCAGGGGTTGGG - Intronic
918762768 1:188434959-188434981 TGGTCTGTGGCCCAGGGGTTGGG + Intergenic
919962071 1:202481223-202481245 TGGTCTGCAGCCCGGGGGTTGGG + Intronic
920146735 1:203867788-203867810 TGGTCTGTGGCCCAGGGGTTAGG + Intronic
921442729 1:215207147-215207169 TGGTCTTCAGCCCAGGGGTTGGG - Intronic
923650318 1:235867135-235867157 CCGGCTGCAGCCCCGCGGGTCGG - Intronic
923896318 1:238274275-238274297 TGGTTTTCATCCCATCGGGTAGG + Intergenic
924801134 1:247330537-247330559 TTGTCTGCACACCAGCGGGGAGG - Intronic
1062940510 10:1417378-1417400 GGGAGTGCAGCCCAGAGGGTCGG + Intronic
1063368828 10:5507845-5507867 TGGACTTCAGCCCAGCAGGTAGG - Intergenic
1063463706 10:6229992-6230014 TGGTCCACAGCCCAGGGGTTAGG + Intronic
1064266922 10:13832713-13832735 AGGCCTGCAGGCCAGGGGGTAGG + Intronic
1064303863 10:14147789-14147811 TGGTCCACAGCCCAGGGGTTAGG + Intronic
1066658187 10:37713563-37713585 TGGTCTGCAAACCAGTGGGGTGG - Intergenic
1067224620 10:44367572-44367594 TGGTCTGCAGCCTGGGGGTTGGG - Intergenic
1067374427 10:45714354-45714376 TGGTCTGCAGCCCAGGGTTGGGG - Intergenic
1067379253 10:45757905-45757927 TGGTCTGCAGCCCAGGGTTGGGG + Intronic
1067882238 10:50055996-50056018 TGGTCTGCAGCCCAGGGTTGGGG - Intergenic
1067886955 10:50098568-50098590 TGGTCTGCAGCCCAGGGTTGGGG + Intronic
1068334833 10:55621410-55621432 TGGTCTGCAGCCCCTGGGGTGGG - Intronic
1068676326 10:59773373-59773395 TGGTCTGCAGCCCGGGGATTGGG - Intergenic
1069218654 10:65854658-65854680 TGGTCTGTGGCCCAGGGGTTGGG + Intergenic
1069822384 10:71235755-71235777 TGGTCTGAAGCCCAGTTGGTGGG - Intronic
1071850858 10:89569114-89569136 TGGTCCACAGCCCAGGGGTTGGG - Intergenic
1072319127 10:94231937-94231959 TGGTCTGCGGCCCAGGGGTGGGG + Intronic
1073034733 10:100555636-100555658 TGGCCTGTAGCCCAGAGGGATGG - Exonic
1073587818 10:104727665-104727687 TGGTCTACAGCCCAGGGGTTGGG - Intronic
1074124511 10:110517424-110517446 CAGTCTGCAGCCCAGGGGTTGGG - Intergenic
1074453844 10:113580707-113580729 TGTTCAGAAGCCCAGGGGGTGGG + Intronic
1076803697 10:132844727-132844749 TGGTCTGCAGCCGTGCGGGAGGG + Intronic
1077542968 11:3156148-3156170 GGGTCAGCAGCCCAGCGAGATGG - Intronic
1079718147 11:23774508-23774530 TGGTCAGCAGCCCAGGGTATTGG + Intergenic
1081061029 11:38477868-38477890 AGGTCTGCAGCCCAGGGGTTGGG - Intergenic
1081753308 11:45527576-45527598 AGGTGTGCAGCCCACCTGGTAGG + Intergenic
1082841468 11:57693444-57693466 TGGTCTGCGGCCCAGGGGTTGGG + Intronic
1083299458 11:61732741-61732763 AGGCCTGCAGCCCAGGGTGTTGG + Intronic
1085591345 11:77764171-77764193 TGGTCTGTGGCCCAGGGGTTGGG + Intronic
1086575510 11:88335595-88335617 TGCTATGCAGCCCAGCAGGCAGG + Intronic
1087619829 11:100528648-100528670 TGATGTGGAGCCCAGAGGGTTGG + Intergenic
1087656500 11:100929359-100929381 TGGCCTGCAGCCCAGGGATTGGG + Intronic
1088444833 11:109914863-109914885 TGATCTGCAGCCAAGCATGTGGG - Intergenic
1088513862 11:110606572-110606594 TGGGCTGCAGCCAGGCGGCTGGG + Exonic
1088736239 11:112729934-112729956 TGGTCTGTGGCCCAGGGGGTGGG - Intergenic
1088806621 11:113358675-113358697 TGATGTGGAGCCCAGAGGGTTGG - Intronic
1089155480 11:116398855-116398877 TGGCCTGCAGGCCAGTGGGGTGG - Intergenic
1089158599 11:116421092-116421114 TGGTCTGTGGCCCAGGGGTTGGG + Intergenic
1090249681 11:125242545-125242567 TGGACTGCTGCCCAGCTGGTGGG + Intronic
1090709937 11:129375408-129375430 GTGTCCGCAGCCCAGCGGGAGGG - Intergenic
1091115594 11:133009864-133009886 TGGTCCACAGCCCAGAGGTTGGG + Intronic
1091755235 12:3047034-3047056 TGGCCTGCAGCCCAGGGGTTGGG - Intergenic
1092063029 12:5566059-5566081 TGCTCTGCAGCCGGGGGGGTTGG + Intronic
1092410572 12:8249991-8250013 TGCTCTGTCGCCCAGCAGGTTGG + Intergenic
1092820293 12:12347485-12347507 TGGTCTGCGGCCCAGGGGTTGGG + Intronic
1093662057 12:21768295-21768317 TGGTCTGCAGCCCAAGGATTGGG + Intronic
1094344149 12:29448310-29448332 TGGTCTGCGGCCCGGGGGTTGGG + Intronic
1095914838 12:47467266-47467288 TGGTCTGCAGTCTAGGGGATGGG + Intergenic
1097906622 12:64926501-64926523 CGGTCTGCAGCCTGGCGGTTGGG - Intergenic
1097925061 12:65117974-65117996 TGGTCTGTGGCCCAGAGGTTGGG + Intronic
1098172685 12:67762779-67762801 TAGTCTGTAGCCCGGGGGGTTGG - Intergenic
1101721416 12:107353629-107353651 TGGTCCACAGCCCAGGGGTTGGG - Intronic
1102861482 12:116340018-116340040 TGGCCTGCAGCCCACTGAGTGGG + Intergenic
1102879909 12:116476428-116476450 TGCTCTGCAGAACAGCTGGTTGG - Intergenic
1103719141 12:122964199-122964221 TGGACAGCAGCCCAGGGGCTTGG + Intronic
1104387184 12:128361177-128361199 TGGTCTGTAACCCAGAGGATTGG + Intronic
1108333363 13:49412956-49412978 AGGTCTGCAGCCCAGGGGTAAGG + Exonic
1111763665 13:92498622-92498644 TGGTTTGCAGGGCAGAGGGTGGG + Intronic
1111989827 13:95105361-95105383 TGGTCTGTGGCCCAGGGGTTGGG + Intronic
1112165131 13:96910165-96910187 TGGTCCACAGCCCAGGGGTTGGG - Intergenic
1112767707 13:102763325-102763347 TGGTCTGCAGCCCGGGGGTTGGG - Intergenic
1114598078 14:23931318-23931340 TGGTCTGTAGCCCAGGGATTGGG - Intergenic
1115021021 14:28681962-28681984 TGGTCTGCAGCCTGGGGGTTGGG + Intergenic
1116009924 14:39339264-39339286 TGGCCCGCAGCCCAGGGGTTAGG + Intronic
1117558122 14:56907404-56907426 TGGTCTGTGGCCCAGGGGCTGGG + Intergenic
1119600015 14:75969353-75969375 TGGTCTGATGCTCAGTGGGTTGG - Intronic
1120132573 14:80824173-80824195 TGGTGTGCAGCCTAGGGGCTTGG - Intronic
1121621956 14:95356379-95356401 GGGTCAGGAGCCCAGCTGGTTGG - Intergenic
1122334646 14:100963436-100963458 TGGTCCGCAGCCCTGAGGTTAGG - Intergenic
1122531641 14:102431977-102431999 TGGCCTGGAGCCCAGGGGGCAGG - Exonic
1123020685 14:105396446-105396468 TGCTCTGCAGCCCAGCTTGGGGG - Exonic
1123725285 15:23095494-23095516 TGGTCTAGAGCCCAGCAGGGTGG + Intergenic
1125037336 15:35141023-35141045 TGCTGTGCAGGCCAGCTGGTGGG - Intergenic
1125643533 15:41251469-41251491 TGGTCTGCAACCCAGAGGTTGGG - Intronic
1126434126 15:48618631-48618653 TGGTCTGTGGCCCAGGGGTTGGG - Intronic
1126849762 15:52789789-52789811 GGGGCTGCCGCCCAGCAGGTCGG + Exonic
1129748387 15:78041338-78041360 AGGTCTGTAGCTCAGCTGGTGGG + Intronic
1130853283 15:87819030-87819052 TGGTCTGTAGGACAGAGGGTGGG + Intergenic
1131349935 15:91690274-91690296 TGGTCTGCGGCCCGGGGGTTGGG + Intergenic
1132076476 15:98825393-98825415 TGGTCTGTGGCCCAGGGGTTGGG - Intronic
1134207673 16:12251025-12251047 TGGCCCGCAGCCCAGAGGGCAGG - Intronic
1134346583 16:13397468-13397490 TGTACTGCACCCCAGCGGGGCGG - Intergenic
1134438930 16:14286038-14286060 GGGTCTGCAGTCCAGGGGGAAGG - Intergenic
1135105476 16:19645679-19645701 AGCTCTGCAGCCCAGCAGGTGGG + Intronic
1135615085 16:23904170-23904192 TGGCCTGCAGCTAAGGGGGTGGG + Intronic
1135868310 16:26125532-26125554 TGGTCTGCAGCCCAGCGGTTGGG + Intronic
1136082999 16:27865131-27865153 TGGTCAGGAGCCCAGAGTGTGGG - Intronic
1139583547 16:67886742-67886764 TGGTCAGGAGCCCAGAGGCTGGG - Intronic
1140418670 16:74797575-74797597 CGGTCTGCAGCCCAGGGGCTGGG + Intergenic
1142144575 16:88487556-88487578 GGGTCTGCAGCCGAGGGGCTGGG + Intronic
1142548919 17:725750-725772 AGGTCTGAAGCCCAGCGTGGTGG + Intergenic
1143116471 17:4584408-4584430 TGCCCTGGAGCCCAGCGGGACGG - Intronic
1143209571 17:5175153-5175175 TGGTCTGTAGCCCAGGAGTTGGG - Intergenic
1144557861 17:16297847-16297869 TGGTCTGCAGCCTGGGGGTTGGG - Intronic
1144617835 17:16792568-16792590 TGGTCTGTAGCCCAGGAGTTAGG + Intronic
1144619051 17:16804613-16804635 TGGTCTGTAGCCCAGGAGTTAGG - Intergenic
1144893650 17:18511082-18511104 TGGTCTGTAGCCCAGGAGTTGGG + Intergenic
1144894869 17:18523114-18523136 TGGTCTGTAGCCCAGGAGTTGGG - Intergenic
1145137355 17:20421120-20421142 TGGTCTGTAGCCCAGGAGTTGGG + Intergenic
1145138573 17:20433192-20433214 TGGTCTGTAGCCCAGGAGTTGGG - Intergenic
1145191665 17:20846430-20846452 TGGTCTGCAGCTCCTGGGGTGGG - Intronic
1145401878 17:22546427-22546449 TGGTCTGCAGCTCCTGGGGTGGG - Intergenic
1145777806 17:27541415-27541437 TGGGGTACAGCCCAGAGGGTAGG + Intronic
1146846046 17:36182880-36182902 GGGTCTGCGGCCCCGCGGCTGGG - Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1149172389 17:53825693-53825715 CGGTCTGCAGCCCAGGGGTTGGG + Intergenic
1149870570 17:60177051-60177073 TGGTCTGTAGCCCAGGAGTTTGG + Intergenic
1150417710 17:65000908-65000930 TGGTCTGTGGCCCAGAGGTTGGG - Intergenic
1150482726 17:65523012-65523034 AGGTCTGCAGCCCAGGGGCTGGG + Intergenic
1150517118 17:65825452-65825474 GGGTCTGCAGCCCAGGGGCTGGG + Intronic
1151263663 17:72936992-72937014 TGGTCTGCTGCCCAGGGGTTGGG + Intronic
1151570398 17:74922949-74922971 TGGTAGGCAGCCCAGAGAGTGGG + Exonic
1151924315 17:77182972-77182994 TGGTGCGCAGCACAGCGGGACGG - Intronic
1152922712 17:83073822-83073844 TGGGCAGCTGCCCAGCGCGTGGG - Intergenic
1153701494 18:7698951-7698973 TGGTCCCCAGCCCAGGGGTTGGG - Intronic
1154345208 18:13537623-13537645 TCGTCTGCAGCCCAGAGGTTGGG + Intronic
1155612528 18:27682901-27682923 TGGTCTGCAGGCCTGGGGGTTGG + Intergenic
1156419071 18:36931217-36931239 TGGTCTGCAGCCCAGGGGCTGGG - Intronic
1157442602 18:47722096-47722118 TGGTCAGCGGCCCGGCAGGTGGG - Intergenic
1157572706 18:48723579-48723601 TGGTGGGCAGCTCAGGGGGTGGG + Intronic
1157808544 18:50676922-50676944 TGGTCCTCAGCCCAGGGGTTGGG - Intronic
1159900048 18:74037386-74037408 TGGTCTGTGGCCCAGGGGTTGGG + Intergenic
1161209198 19:3057450-3057472 CGGTCTGCAACCCGGCGGTTTGG + Intronic
1161322650 19:3648507-3648529 GGGTCTGCAGCCCCACAGGTGGG - Intronic
1161322660 19:3648535-3648557 GGGTCTGCAGCCCCACAGGTGGG - Intronic
1161907773 19:7170009-7170031 TGGTCTGTGGCCCAGGGGCTGGG - Intronic
1162743518 19:12786533-12786555 TGGTCTGGAGCCCAGGGCCTGGG + Intronic
1163067775 19:14811933-14811955 TGGTCTGTGGCCCAGGGGTTGGG + Intronic
1163290692 19:16377358-16377380 TGTTGTGCAGTCCAGAGGGTAGG - Intronic
1164498768 19:28793924-28793946 TGGGCCGCAGCCCCGCGCGTGGG - Intergenic
1164600875 19:29562507-29562529 GGGGCTGCAGCCCAGCTGGTGGG + Intronic
1165209631 19:34223638-34223660 AGGTCTGAAGCCCAACTGGTGGG - Intronic
1165242423 19:34479516-34479538 TGGTCTGTGGCCCAGGGGTTGGG - Intergenic
1165257770 19:34589920-34589942 TGGCCTGGAGCCCAGGGAGTTGG + Intergenic
1166128483 19:40731146-40731168 TGGTCTGCGGCCCAGGGGTTGGG - Intronic
1167053838 19:47096375-47096397 TGGGCCGCACCCCAGCGGGAAGG - Intronic
1167601111 19:50455402-50455424 TGGTCAGAAGGCCAGGGGGTAGG - Intronic
1167998597 19:53426518-53426540 CGGTCTGCAGCCCAGGGGTGGGG - Intronic
1168405144 19:56106762-56106784 GGGTCTGCAGACCAGCACGTGGG + Intronic
1168455304 19:56502915-56502937 CGGTCTGCGGCCCAGGGGTTGGG - Intergenic
927880431 2:26686371-26686393 TGGTCCGGAGCCCAGCAGGGGGG + Intergenic
928040567 2:27872167-27872189 TGGTCTGTGGCCCAGGGGTTGGG + Intronic
928097195 2:28412070-28412092 TGGGCTGCAGCCCAGGGGCTGGG - Exonic
928239803 2:29576615-29576637 TGGTCTGTGGCCCTGGGGGTTGG - Intronic
929205419 2:39286381-39286403 TGGTCTGCGGCCCAGGGGTTAGG + Intronic
929815767 2:45230128-45230150 TGGTCTGCAGCCCAGGGGTTGGG - Intergenic
930007492 2:46909737-46909759 TGGGCTGCAGCCTAGAGGGTAGG + Intronic
930948381 2:57105806-57105828 TGGTCTGCTGTCCAGGGGTTGGG - Intergenic
931011135 2:57915732-57915754 TGGTCTGCAGCCCAGCGGGTTGG - Intronic
931198103 2:60072379-60072401 TGGTCTTCTGCCCAGCGTGCAGG + Intergenic
933074658 2:77907818-77907840 TGGTCTGCATACCAGGGGTTGGG - Intergenic
933845509 2:86323372-86323394 TTGTCTGCAGCCCAGGGGTTGGG - Intronic
937258017 2:120568395-120568417 TGGTCAGCACCTCAGCAGGTTGG - Intergenic
937958766 2:127438664-127438686 AGGACTGCAGCCCTGTGGGTGGG - Intronic
941002723 2:160218703-160218725 GGGTCTGCAGCCCAGGGGTTGGG - Intronic
941293461 2:163705212-163705234 AGGTCTGCAGCCCACAGTGTGGG + Intronic
941540078 2:166771570-166771592 CGGTATGGAGCCCAGAGGGTTGG - Intergenic
942009935 2:171751281-171751303 TGGTTTGCGGCCCAGGGGTTGGG + Intergenic
946029871 2:216695285-216695307 TTGGCTGCAGCCGAGAGGGTGGG + Exonic
946881742 2:224183280-224183302 TGGTCATCAGCCCAGGAGGTTGG - Intergenic
948802981 2:240441188-240441210 TGATGTGCAGCCCTGCGGTTCGG - Intronic
948975225 2:241459696-241459718 TGGCCTGCAGCCCAGCTTGCTGG + Intronic
1169482899 20:6001370-6001392 TGGTCCACAGCCCAGGGGTTGGG + Intergenic
1170548247 20:17453659-17453681 AGGTCTCCAGCCCAGGGGTTGGG - Intronic
1173725908 20:45297756-45297778 TGGTCTGCAGGCCAGCGGCAGGG - Intronic
1173877453 20:46383267-46383289 TGGTCTGGAGCCCAGGAGGGTGG - Intronic
1174044427 20:47723449-47723471 CTGTCTGCAGCCCAGGGGTTGGG - Intronic
1175724831 20:61310636-61310658 GGGTCTGCAGCCCCGGGGTTGGG + Intronic
1177600037 21:23299112-23299134 CAGTCTGCAGCCCAGGGGTTGGG - Intergenic
1178325305 21:31640972-31640994 TGGTCTGCAGCCCAGGGATTGGG + Intergenic
1179559093 21:42201470-42201492 TGGTCTGCAGCCCAGGGGTTGGG + Intronic
1179708446 21:43195679-43195701 TGTTCTGCAGCCCCGTGGATAGG + Intergenic
1180897246 22:19345701-19345723 TGGTCTGTGGCCCAGAGGTTGGG + Intronic
1181780617 22:25190460-25190482 CGGTCTGTGGCCCAGGGGGTTGG + Intronic
1183057864 22:35318084-35318106 GCCTCTGCAGCCAAGCGGGTTGG - Intronic
1183953061 22:41363048-41363070 TGGTCTTCAGCCCTGTGAGTAGG + Intergenic
1184302592 22:43570930-43570952 TGGTCTGCAGAGCAGCGGCCTGG + Intronic
1184864751 22:47195887-47195909 TGTCCTGCAGCCCAGGGGGAGGG - Intergenic
1185083454 22:48722806-48722828 TGGCGTGCAGCCCAGCTGATTGG - Intronic
950219069 3:11180572-11180594 CGGTCCGCAGCCCAGGGGTTGGG + Intronic
951301601 3:21004689-21004711 GGGTCTGCAGCCCAGGGGATGGG + Intergenic
951369275 3:21825779-21825801 TGGTCCGCAGCCCGGAGGCTGGG - Intronic
952351963 3:32548140-32548162 CGGTCCACAGCCCAGTGGGTTGG - Intronic
953662925 3:44904060-44904082 GGGTATGCAGCCAAGCAGGTGGG + Intronic
953748433 3:45592690-45592712 TGGTCAGTAGCCCAGGGGTTGGG + Intronic
953785603 3:45908838-45908860 TGGTCTGTGGCCCAGGGGTTGGG - Intronic
954505706 3:51070729-51070751 GGGTCCGCAGCCCAGGGGATGGG - Intronic
955347168 3:58169776-58169798 TGGACTGCAGCAAAGCTGGTAGG + Exonic
955617573 3:60825478-60825500 TGGTCTGCCGCCTGGCGGTTGGG - Intronic
955992491 3:64642874-64642896 AGGTCTGAAGGCCAGGGGGTGGG + Intronic
956331806 3:68118471-68118493 TGGTCTGTGGCCCAGGGGTTAGG + Intronic
956987866 3:74724184-74724206 TGGTCTGCTGCACAGCGGTTGGG - Intergenic
957055805 3:75442100-75442122 TGCTCTGTCGCCCAGCAGGTTGG + Intergenic
958758180 3:98275029-98275051 TGGCCTGCAGCCCTGGGGCTGGG - Intergenic
959294238 3:104514913-104514935 TGATCTGCAGCCCAGGGGTTGGG - Intergenic
960149182 3:114232899-114232921 TGGACTACAGCCCAGCAAGTGGG - Intergenic
960879720 3:122332133-122332155 TGGTCTGCAGCCCAGGGGTTGGG + Intronic
961136977 3:124520483-124520505 TAGTCTGCAGCCCAGGGGTTGGG - Intronic
961841999 3:129722129-129722151 TGGTCTGCGGCCCAGGGGTTGGG - Intronic
962744812 3:138389460-138389482 TGGACTGCATCCCAGCTGGAAGG + Intronic
963603895 3:147398101-147398123 TGGCCAGCAGGCCTGCGGGTGGG - Intronic
964819355 3:160754424-160754446 TGCTCTCCAGCCCAGCGGACTGG + Intergenic
965304840 3:167051529-167051551 TGGTCTCCAGCCCTGGGGGTTGG - Intergenic
968599956 4:1504096-1504118 ACTTCTGCAGCTCAGCGGGTGGG + Intergenic
968618568 4:1593227-1593249 TGGTCTGCAACCCAGACGTTTGG + Intergenic
968702182 4:2062394-2062416 TGGTGGGCAGGCCAGCTGGTGGG + Intronic
968746707 4:2364226-2364248 TGGTCTGCAGCCAGGCCGGGTGG - Intronic
969055566 4:4400004-4400026 TGGTCTGCAGCCCAGGGGTTCGG + Intronic
969110438 4:4840887-4840909 TGTTCTGCAGCCAAGGGGCTGGG - Intergenic
969858896 4:10020758-10020780 TGGTCTGCACCCCATCAGATTGG + Intronic
972622561 4:40762642-40762664 TGGTCTGCAGCCCTGGGGTTGGG - Intronic
973205438 4:47555090-47555112 CGGTCTGCAACCAAGGGGGTTGG - Intronic
976482873 4:85564872-85564894 TGGTCTGTGGCCGAGGGGGTTGG + Intronic
979835241 4:125358747-125358769 TGGTCTGTGGCCCAGGGGTTGGG + Intronic
983040829 4:162923793-162923815 TGGTCCACAGCCCAGCGGTTGGG - Intergenic
985344174 4:188985500-188985522 TGGTCAGCAGCCCAGGGGCTGGG + Intergenic
986218003 5:5738979-5739001 TGCTCAGCAGCCCAAGGGGTGGG - Intergenic
986445764 5:7819911-7819933 TGGTCAGCAGCTCTGGGGGTGGG - Intronic
986649537 5:9949534-9949556 GGGTCTGCGGCCCAGGGGTTGGG + Intergenic
986783676 5:11090393-11090415 TGGTCTGCGGCCCGGGGGTTGGG - Intronic
987012913 5:13785359-13785381 TGGTCTGCGGCCCCGGGGCTGGG + Intronic
987222473 5:15804586-15804608 TGGTCTGCGGCCTAGGGGTTGGG - Intronic
987230619 5:15890111-15890133 TGGTCTGTGGCCCAGGGGCTAGG - Intronic
989469190 5:41795324-41795346 TGGTCCACAGCCCAGGGGTTAGG + Intronic
990442564 5:55861295-55861317 TGGTCTGCAGCCTGGGGGTTGGG - Intronic
990601632 5:57364699-57364721 TGGGCAGCAGGCCAGAGGGTGGG + Intergenic
993342159 5:86738299-86738321 TGGTCTGTGGCCCAGGGGTTGGG + Intergenic
993970556 5:94414709-94414731 TGGTCTGCAGTCTAGGGGTTGGG - Intronic
996785265 5:127230402-127230424 TGGTCTACATCCAAGCGGGAAGG + Intergenic
997281163 5:132646847-132646869 TGGTCTGCAGCCCGGGGGTTGGG + Intergenic
997415098 5:133722080-133722102 TGGTCTGTGGCCCAGGGGTTGGG - Intergenic
997647613 5:135491555-135491577 TGGTCTCCAGAGCTGCGGGTGGG - Intergenic
998481583 5:142467544-142467566 GGGTCTGCAGCCCAGGGTTTGGG - Intergenic
999234356 5:150081557-150081579 TGGTCTGCAGCACAGTGGGATGG + Intronic
1000621263 5:163489295-163489317 TGGTCTGTAGCCCGGAGGTTGGG + Intronic
1000814087 5:165899082-165899104 TGGTCGGCGGCCCAGGGGCTGGG - Intergenic
1000937565 5:167321570-167321592 TTGTTTCCAGCCCAGCGGTTAGG + Intronic
1001350931 5:170963783-170963805 CGGTCTGCAGCCCAGGGTTTGGG + Intronic
1001538096 5:172513873-172513895 TGGTCCACAGCCCAGGGGTTGGG - Intergenic
1002323675 5:178390974-178390996 TGGTCCACAGCCCAGGGGTTGGG - Intronic
1002954172 6:1845891-1845913 TGGTCTGTGGCTCAGGGGGTTGG + Intronic
1003486485 6:6584577-6584599 TGGTCTGTGGCCCAGGGGTTAGG + Intergenic
1003634626 6:7821052-7821074 GGGTCTGCAGCCCTGGGGTTGGG + Intronic
1004549687 6:16634978-16635000 AGGTCTGTAGCCCAGGGGTTGGG - Intronic
1004597562 6:17114798-17114820 TGGTATGTGGCCCAGGGGGTTGG + Intronic
1004795620 6:19080141-19080163 TGGCCTGCAGCTCAGGGGTTGGG - Intergenic
1004897271 6:20160984-20161006 TGGTCTGTGGCCCGGGGGGTTGG - Intronic
1005387981 6:25304677-25304699 TGGTCCACAGCCCAGGGGTTGGG + Intronic
1006134043 6:31884976-31884998 TGCTCTGCAGCCCAGATGATGGG + Exonic
1006214565 6:32429209-32429231 TGGTCTGTGGCCCAGGGGTTGGG + Intergenic
1008459959 6:51757133-51757155 TGGTCTGTGGCCCTGGGGGTTGG + Intronic
1010547185 6:77173017-77173039 TGATGTGGAGCCCAGAGGGTTGG - Intergenic
1010740286 6:79494989-79495011 CAGTCTGCAGCCCAGGGGTTGGG - Intronic
1011178264 6:84588455-84588477 TGGTCTGCAGCTCACCGCGAAGG + Intergenic
1014292352 6:119573134-119573156 TGGTCTGCAGCCTGGGGGTTAGG + Intergenic
1014712492 6:124823570-124823592 TCCTCTGCAGCCCAGCGGGTTGG + Exonic
1015066813 6:129039915-129039937 TGGTCTGCAGCCCTGGGGTTGGG + Intronic
1019893876 7:3967852-3967874 AGGTCTGCAGCCCAGGGCTTGGG + Intronic
1020383505 7:7570897-7570919 TGGTCTGCGGCCCTGGGAGTTGG + Intronic
1021214815 7:17902747-17902769 TGGTCTGCAGCCTGGGGGTTGGG - Intronic
1022484690 7:30769395-30769417 CGGTCCACAGCCCAGGGGGTTGG + Intronic
1023470244 7:40509528-40509550 TTGCCTGAAGTCCAGCGGGTAGG + Intronic
1023848636 7:44138474-44138496 TGCCCAACAGCCCAGCGGGTGGG - Intergenic
1024617849 7:51130604-51130626 TGGTCTGCAGCCCAGCTCTCAGG + Intronic
1025739725 7:64184579-64184601 TGGACTGCAGCGCAGTGGGTGGG + Intronic
1026001053 7:66558907-66558929 TGGACTGCAGCGCAGTGGGTTGG + Intergenic
1026911368 7:74093608-74093630 TGCTCTGCAGCCCAGGTGGCTGG - Intronic
1027426688 7:78068361-78068383 GGATCTGCAGCCCAGGGGTTGGG + Intronic
1029458231 7:100681684-100681706 TGGCCTACAGCCCAGGGGCTGGG + Exonic
1032109071 7:129059924-129059946 GGGACTGAAGCCCAGGGGGTGGG + Intergenic
1034449981 7:151132119-151132141 TGGCCTGCAGCCCAGGGTGCTGG + Intronic
1034949086 7:155284953-155284975 TGGTCTGCAGCCCTGGGGAAGGG - Intergenic
1034949101 7:155285002-155285024 TAGTCTGCAGCCCTGAGGATGGG - Intergenic
1036749341 8:11434201-11434223 GAGGCTGCAGCCCAGCGGGAGGG + Intronic
1037997862 8:23366727-23366749 TGGGCTGCAGCTCAGCCGGGCGG + Intronic
1038004205 8:23416314-23416336 TGGGCTGCAGCCCGGAGCGTGGG - Intronic
1038033002 8:23661345-23661367 TGCTGTGCAGCCCAGCGGCAGGG + Intergenic
1038324454 8:26561919-26561941 TGGTCTGCAGCCCAGGGGTTGGG + Intronic
1043347073 8:79310776-79310798 TGGTCTGCAGCCTCGGGGTTGGG + Intergenic
1044860128 8:96514897-96514919 TGGTCTGTGGCCCCGGGGGTCGG + Intronic
1045294418 8:100861053-100861075 TGGTCTGCGGCCCAAGGGTTGGG + Intergenic
1045672432 8:104571238-104571260 TGGTCTGCAGCCTGGGGGTTAGG - Intronic
1045674204 8:104589482-104589504 TGGGCTCTGGCCCAGCGGGTGGG + Intergenic
1045698126 8:104834507-104834529 TGGTCTGCAGCCCAGGGACTGGG - Intronic
1046600569 8:116312646-116312668 TGGTCTGCAGCCCAGGAGTTGGG - Intergenic
1047537301 8:125731703-125731725 TGGTGTGCAGCCCGTGGGGTGGG + Intergenic
1048209709 8:132444489-132444511 TGCTTTGCAGCCCAGCAGCTGGG + Intronic
1048364848 8:133729819-133729841 TGCTTAGCAGCCCAGAGGGTGGG + Intergenic
1050431616 9:5568238-5568260 CGGTCTGCGGCCCAGAGGTTGGG - Intronic
1051378647 9:16431983-16432005 TAGTCTGCAGCCCCGGGGTTGGG + Intronic
1051468807 9:17411522-17411544 CAGTCTGCAGCCCAGGGGTTAGG - Intronic
1051911224 9:22155065-22155087 TGGACTGCAGCGCAGTGGGTGGG + Intergenic
1052390425 9:27872590-27872612 TGGTCTGCAGCCTAGGGGTTGGG + Intergenic
1052811362 9:33063527-33063549 TGGTCTGCAGTTCAGGGGTTGGG - Intronic
1053005125 9:34599199-34599221 GGGTCAGCAGCCCAGCTGCTGGG - Intergenic
1053072230 9:35108152-35108174 TGGGCTACAGCCCAGCAGGGGGG - Exonic
1056115079 9:83433922-83433944 TGGTCTGTGGCCCAGGGGCTGGG + Intronic
1056306781 9:85298500-85298522 TGGTCTGTGGCCCAGGGGTTGGG + Intergenic
1056751637 9:89356051-89356073 TGGTCTGCAGCCCAGGGGTTGGG - Intronic
1057977634 9:99622937-99622959 TGGTCTGCAGCCCGGGGGGTTGG + Intergenic
1059377788 9:113899368-113899390 TGGTCTGCAGCCTGGAGGCTGGG - Intronic
1060192738 9:121603353-121603375 CTGTCTGCAGCACAGCTGGTAGG - Intronic
1060776157 9:126376463-126376485 TGGGCTGGAGCCCTGTGGGTGGG + Intronic
1060892051 9:127195235-127195257 CGGTCTGAAGCCCGGCGGGAGGG - Intronic
1061043107 9:128150937-128150959 TGGGGTGCAGCCTAGGGGGTCGG + Intronic
1061149315 9:128820019-128820041 CGGTCTGTAGCCCAGGGGTTGGG + Exonic
1061527821 9:131182270-131182292 TGGTCTGCAGCCCAGGGCTGGGG - Intronic
1062034999 9:134379086-134379108 TGGGATGCAGCCCAGCCTGTGGG + Intronic
1062485770 9:136774738-136774760 TGCTCCGCAGCCCTGAGGGTAGG - Intergenic
1062545733 9:137063090-137063112 TGGACTGCAGCGCAGTGGGTGGG - Exonic
1185785092 X:2884076-2884098 TGGTCTGCAGCCCAGGGGTTGGG + Intergenic
1186644137 X:11488544-11488566 TGGTCTGCAGCCCAGGAGTTGGG - Intronic
1187982225 X:24769863-24769885 TCTCCTGCAGCCCTGCGGGTGGG + Intronic
1188753296 X:33929970-33929992 TGGTCCGCAGCCCAGGGACTGGG - Intergenic
1189115142 X:38334773-38334795 AGGTCTGCAGCCCCAGGGGTTGG - Intronic
1189483873 X:41414234-41414256 TGGTCTGTGGCCCAGGGGTTCGG - Intergenic
1189843316 X:45105752-45105774 TGGTCTGCAGCCCAGGGGTTGGG - Intronic
1189880220 X:45483207-45483229 TGGTCTGTGGCCCAGGGGTTAGG + Intergenic
1192263523 X:69523491-69523513 TGCTCTGCAGCCCAGCTGGGAGG + Intronic
1192522849 X:71816553-71816575 TGGTCTGCAGCCCAGTGGTGAGG - Intergenic
1193599569 X:83493722-83493744 TGGTCCCCAGCCCAGTGGCTGGG - Intergenic
1196032704 X:111108397-111108419 TGGTCTGCAGTCCAGAGTTTGGG - Intronic
1196329753 X:114457842-114457864 CAGTCTGCAGCCCAGGGGTTGGG + Intergenic
1197237951 X:124089485-124089507 TGGTCTGCATCCCATAGGTTGGG + Intronic
1198847327 X:140926465-140926487 TGGTCTGTGGCCCAGGGGTTAGG - Intergenic