ID: 931014146

View in Genome Browser
Species Human (GRCh38)
Location 2:57956122-57956144
Sequence GTGGCTAATGCCGCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 17, 3: 32, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931014138_931014146 13 Left 931014138 2:57956086-57956108 CCTGCAGCATTAAAAATAGTATT 0: 1
1: 0
2: 0
3: 23
4: 317
Right 931014146 2:57956122-57956144 GTGGCTAATGCCGCTTTGGGAGG 0: 1
1: 1
2: 17
3: 32
4: 87
931014137_931014146 14 Left 931014137 2:57956085-57956107 CCCTGCAGCATTAAAAATAGTAT 0: 1
1: 0
2: 1
3: 25
4: 309
Right 931014146 2:57956122-57956144 GTGGCTAATGCCGCTTTGGGAGG 0: 1
1: 1
2: 17
3: 32
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931014146 Original CRISPR GTGGCTAATGCCGCTTTGGG AGG Intronic
901095049 1:6671786-6671808 GTGGCTCACGCCACTTTGGGAGG - Intronic
901561185 1:10072121-10072143 GGGGCTGATGCCGCTATGGGAGG - Exonic
901778482 1:11576790-11576812 GTGGCTCATGCCACTTTGAAAGG + Intergenic
902516691 1:16993456-16993478 GTGGCTCCCGGCGCTTTGGGAGG - Intronic
902827766 1:18988822-18988844 GTGGCTCATTCCTCTTTGTGTGG + Intergenic
903763533 1:25716581-25716603 GTGGCTTATGCCTGTTTGGGAGG - Intronic
905677073 1:39834135-39834157 GTGGCTCATGCCACATTGGGAGG - Intergenic
906106003 1:43293027-43293049 GGGGCTAATTCCTCTCTGGGAGG - Intergenic
908710437 1:67008391-67008413 GTTGGTAGTGCCACTTTGGGAGG - Intronic
910887737 1:91983936-91983958 GTGGCTCACGCCACTTTGGGAGG - Intronic
911304623 1:96217759-96217781 TTGGCTAAGGCAGTTTTGGGAGG - Intergenic
912619931 1:111145270-111145292 GTGGCTCACGCCACTTTGGGAGG - Intronic
912994334 1:114518079-114518101 GTGGCTTATGCCACTTTGGGAGG + Intergenic
914817650 1:151074882-151074904 GTGGCTCACACCACTTTGGGAGG + Intronic
915996311 1:160567721-160567743 GAGGCTAATGCTGCCTTTGGTGG + Intronic
916237012 1:162600037-162600059 TTGCCAAATGCCCCTTTGGGTGG - Intergenic
916465184 1:165066918-165066940 GTGGCCATTGCTGCTTTGGCTGG - Intergenic
919486488 1:198154349-198154371 GTGGCTCACACCACTTTGGGAGG + Intergenic
922439262 1:225638973-225638995 GAGGCTAATGCTGCTTTGGGAGG - Intronic
922448714 1:225719330-225719352 GTGGCTCACACCACTTTGGGAGG - Intergenic
922927757 1:229364570-229364592 GTGGCCCATCCCGCTTTGGAAGG - Intergenic
924190665 1:241548940-241548962 GTGGCTCCTGGCACTTTGGGAGG + Intronic
1065322309 10:24521075-24521097 GTGGCTCATGCCACTTTGGGAGG + Intronic
1065356479 10:24846693-24846715 GTGGCTCATGACGCTTCTGGAGG + Intergenic
1069240823 10:66137076-66137098 GTGGCTCAAGCCACTTTGGGAGG - Intronic
1069251724 10:66275372-66275394 GTGGCTCACGCCTGTTTGGGAGG - Intronic
1073534883 10:104267937-104267959 GTGGCTCATGCCACTTTGGGAGG - Intergenic
1077516642 11:3006187-3006209 GTGGCTCATGCCACTTTAGGAGG + Intronic
1081985199 11:47297028-47297050 GTGGCTCATGCCACTTTAAGAGG - Intronic
1083401930 11:62429533-62429555 GTGGCTCAAGCCACTGTGGGAGG + Intergenic
1084183523 11:67458320-67458342 GAGGCTGAGGCAGCTTTGGGTGG + Intronic
1086347245 11:85909492-85909514 GTAGCTCAGGCTGCTTTGGGTGG + Intronic
1088345868 11:108824297-108824319 GTGGCTCATGCCACTTTGCGAGG - Intronic
1097266745 12:57750307-57750329 GTAGCTTATGCTACTTTGGGAGG + Intronic
1099207006 12:79740075-79740097 GTGGCTCAGGCCACTTTGGGAGG - Intergenic
1101380750 12:104212035-104212057 GTGGCTCACGCCACTTTGGGAGG + Intergenic
1106386987 13:29296465-29296487 GTGGCTAATGCCACTTTGGGAGG - Intronic
1106493347 13:30249451-30249473 GTGAGTAATGCTGCTTTGGATGG - Intronic
1107614947 13:42156495-42156517 TTTGCTCATGCCTCTTTGGGAGG - Intronic
1109369518 13:61403616-61403638 GTGGATGATGCCTTTTTGGGGGG + Intergenic
1111523820 13:89440788-89440810 GTGGCTCACACCACTTTGGGAGG - Intergenic
1118580863 14:67296074-67296096 GTGCCTAATTCTGTTTTGGGAGG + Intronic
1118662876 14:68034078-68034100 GTTGTTAATGTAGCTTTGGGGGG + Intronic
1119783401 14:77294565-77294587 GTGGCTTATGCCGAGGTGGGCGG - Intronic
1120439548 14:84519662-84519684 GTGGCTAGTGCAGATTTGTGGGG + Intergenic
1122556423 14:102583145-102583167 GTGGCTCACACAGCTTTGGGAGG - Intergenic
1125181077 15:36881194-36881216 CTGTCTAATACGGCTTTGGGGGG + Intergenic
1125698763 15:41661347-41661369 TTGGCTACTGGAGCTTTGGGGGG - Intronic
1126791223 15:52222893-52222915 GTGGCTTATGCCACTTTGGGAGG + Intronic
1128582096 15:68817886-68817908 GTGGCTGTTGTCGCTGTGGGGGG - Intronic
1135082796 16:19450776-19450798 GTGGCTAATGCCTGTGTTGGTGG + Intronic
1135418395 16:22287102-22287124 GTGGCTCACGCCACTTTGGGAGG + Exonic
1140322901 16:73971031-73971053 GTGGCTAATTCTGCTGAGGGAGG - Intergenic
1145103955 17:20099414-20099436 GTGGCTTATGCCACTTTGGGAGG + Intronic
1145881728 17:28357352-28357374 GTGGCCAAGGCCGCTCTGTGCGG - Exonic
1145949535 17:28805276-28805298 GTGGCTCACACCACTTTGGGAGG + Intronic
1146190336 17:30759966-30759988 GTGGCTCACGCCCCCTTGGGAGG - Intergenic
1146335507 17:31966600-31966622 GTGGCTCACGCCCCCTTGGGAGG - Intronic
1147523036 17:41192800-41192822 AAGGCTAATTCAGCTTTGGGAGG + Intronic
1148544739 17:48509002-48509024 ATGGCTCATGCCGCTTTGGGAGG + Intergenic
1153876142 18:9373270-9373292 GTGGCTCATGCCACTTTGGGAGG + Intronic
1154318145 18:13322566-13322588 GTGGCTCACGCCACTTTGGGAGG - Intronic
1154421483 18:14233203-14233225 GTGGCTCATGCCACTTTGGGAGG - Intergenic
1156831562 18:41498117-41498139 GTGGCTCACGCCACTTTGGGAGG - Intergenic
1161884118 19:6980363-6980385 GTGGGTCATGCCACTTTGGGAGG - Intergenic
1165447271 19:35863150-35863172 GTTGGTAATACCACTTTGGGAGG + Intronic
928527538 2:32157845-32157867 GTGGCTCATGCCTGTTTGGGAGG + Intergenic
929540758 2:42818811-42818833 GTGGCTTATGCCCCTTTGGGAGG + Intergenic
931014146 2:57956122-57956144 GTGGCTAATGCCGCTTTGGGAGG + Intronic
934496664 2:94807958-94807980 GTGGCTCATGTCACTTTGGGAGG + Intergenic
935367418 2:102309102-102309124 GTGGCTTCTGGCACTTTGGGAGG - Intergenic
939934006 2:148267091-148267113 GAGGCTAATGTTGATTTGGGAGG + Intronic
946078788 2:217098467-217098489 GTGGCTCATGCCACTTTGGGAGG - Intergenic
1169191015 20:3659429-3659451 GTGGGTAATGCCCAGTTGGGAGG + Intronic
1171887963 20:30674693-30674715 GTGGCTCACGTCACTTTGGGAGG + Intergenic
1174369707 20:50078245-50078267 GTGGCTCACGGCACTTTGGGAGG + Intergenic
1176851991 21:13926749-13926771 GTGGCTCATGCCACTTTGGGAGG + Intergenic
1180121933 21:45758143-45758165 GTGGCTCACGCCACTTTGGGAGG - Intronic
1181633167 22:24161972-24161994 GTGGCTACTGCCCCTCTGTGGGG + Intronic
1183374625 22:37456099-37456121 GTGGCTAATGCAGCAGGGGGCGG - Intergenic
1184921622 22:47609477-47609499 GTGGCTCATGCCACTTTAGGAGG - Intergenic
954315773 3:49800787-49800809 GTGGCTTATGCCTGTATGGGAGG + Intergenic
954556836 3:51523936-51523958 GTGGCTCATGCCGAGGTGGGAGG - Intergenic
956089303 3:65648404-65648426 GTGGCTCACACCACTTTGGGAGG - Intronic
957934110 3:86920422-86920444 GTGACTTATGCCACTTCGGGAGG - Intergenic
963294356 3:143529181-143529203 GTGGGAAATGCCCCTCTGGGAGG + Intronic
963335461 3:143970368-143970390 GTGCCTTATGCCGCCTTTGGTGG - Intergenic
967075606 3:185999416-185999438 GTGGCTCACGCCACTTCGGGAGG + Intergenic
967980523 3:195062502-195062524 GTGGCATATGCCGCTGTGGAAGG - Intergenic
969204230 4:5630472-5630494 GTGGCTCATTCTGCTATGGGTGG + Intronic
979997847 4:127454102-127454124 GTGTATAATCCCACTTTGGGAGG + Intergenic
981093890 4:140759115-140759137 GTGGCTTCTGGCACTTTGGGAGG - Intergenic
982708794 4:158738837-158738859 GTGGCTCATGCTACTTTGAGAGG - Intergenic
985281099 4:188286028-188286050 ATGGCTCAAGCCACTTTGGGAGG + Intergenic
987589772 5:19909553-19909575 GTGGCTCATGCCACTTTGGGAGG - Intronic
992803817 5:80317246-80317268 GTGGCTCATGCCACTCTGGGAGG - Intergenic
993879683 5:93347884-93347906 GTGGCTAATGGTGCTTCGGACGG + Intergenic
994083130 5:95730748-95730770 TTTGCTAATGTCGCCTTGGGGGG - Intronic
996147695 5:119995933-119995955 GTGGCTCACGCCACTGTGGGAGG - Intergenic
1007837474 6:44684889-44684911 GTGGCTCATGCCACTTTGGGAGG + Intergenic
1007950933 6:45871741-45871763 GTGAAGAATGCCACTTTGGGAGG + Intergenic
1007967627 6:46016357-46016379 ATGGCAAATGCCCCTTTTGGTGG - Intronic
1010114604 6:72287846-72287868 GTGGCTCATGCCACTATGGGAGG - Intronic
1014056990 6:117027268-117027290 CTGGTAAATGCTGCTTTGGGAGG - Intergenic
1016963420 6:149695415-149695437 GTGGCTCAAGCCACTTTGGGAGG + Intronic
1017156770 6:151329370-151329392 GTGGCTCACACCACTTTGGGAGG - Intronic
1019397039 7:826535-826557 GTGGCAGATGGCGCTCTGGGAGG + Intronic
1019478893 7:1257012-1257034 GTGGCTCATGCCCCTTGGCGGGG - Intergenic
1025986184 7:66454409-66454431 GTGGCTCATGCCACTTTGGGAGG + Intergenic
1027209402 7:76132958-76132980 GTGGCTCATGCCACTTTGGGAGG + Intergenic
1032131950 7:129236595-129236617 GTGTTTTATGCCTCTTTGGGAGG - Intronic
1032582666 7:133117674-133117696 GTTGCTAATGCCACATTGGCTGG - Intergenic
1039699567 8:39948056-39948078 GTGGCTCACGCCACTTTGGAAGG - Intronic
1039733354 8:40303928-40303950 GTGCCTAATGCCAATCTGGGTGG + Intergenic
1041680287 8:60582203-60582225 ATGGCTCATGCCACTTTGGGAGG - Intronic
1042775640 8:72427848-72427870 GTGGCTCATGCCACTTTGGGAGG - Intergenic
1043475842 8:80605549-80605571 GTGGCTCACGCCACTTTGGGAGG - Intergenic
1045243518 8:100422889-100422911 GTGGCTAAGGGGGCTTGGGGTGG + Intergenic
1050491863 9:6196864-6196886 ATGGCTCATGCCACTTTGGAAGG + Intergenic
1053660488 9:40272489-40272511 GTGGCTCATGTCACTTTGGGAGG - Intronic
1053910861 9:42901838-42901860 GTGGCTCATGTCACTTTGGGAGG - Intergenic
1054361493 9:64125401-64125423 GTGGCTCACGTCGCTTTGGGAGG - Intergenic
1054372607 9:64418707-64418729 GTGGCTCATGTCACTTTGGGAGG - Intergenic
1054524123 9:66103796-66103818 GTGGCTCATGTCACTTTGGGAGG + Intergenic
1054680235 9:67908482-67908504 GTGGCTCATGTCACTTTGGGAGG - Intergenic
1054860690 9:69949840-69949862 ATGGCAATTGCCTCTTTGGGTGG + Intergenic
1054899095 9:70348836-70348858 ATGCCTAATCCCACTTTGGGAGG + Intronic
1055285096 9:74720053-74720075 GTGGCACACGCCACTTTGGGAGG - Intergenic
1061071687 9:128314685-128314707 GTGGCTCCTGCCACTTTGGGAGG - Intronic
1203692869 Un_GL000214v1:62722-62744 GTGGCTCACGTCACTTTGGGAGG + Intergenic
1203557054 Un_KI270744v1:9615-9637 GTGGCTCACGTCACTTTGGGAGG + Intergenic
1203643426 Un_KI270751v1:41469-41491 GTGGCTCACGTCACTTTGGGAGG - Intergenic
1187811229 X:23179609-23179631 GTGGCTCACGACACTTTGGGAGG - Intergenic
1187969590 X:24646552-24646574 GTGCCTAATGCCAATTTGGGGGG - Intronic
1192500988 X:71652067-71652089 GTGGCTCATGCCTGTCTGGGAGG - Intergenic
1192527368 X:71859162-71859184 GTGGCTCATGCCTGTCTGGGAGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1200170878 X:154073582-154073604 GTGGCTCACACCACTTTGGGAGG + Intronic