ID: 931018050

View in Genome Browser
Species Human (GRCh38)
Location 2:58008975-58008997
Sequence ACTCACAGGGAGAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 335}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931018040_931018050 27 Left 931018040 2:58008925-58008947 CCAGATGGCACCTTGTTGCTGCA 0: 1
1: 1
2: 7
3: 26
4: 300
Right 931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG 0: 1
1: 0
2: 3
3: 27
4: 335
931018044_931018050 3 Left 931018044 2:58008949-58008971 CCCACAGAGAAGGAGGAATGTGG 0: 1
1: 1
2: 2
3: 30
4: 295
Right 931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG 0: 1
1: 0
2: 3
3: 27
4: 335
931018041_931018050 17 Left 931018041 2:58008935-58008957 CCTTGTTGCTGCATCCCACAGAG 0: 1
1: 1
2: 52
3: 90
4: 383
Right 931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG 0: 1
1: 0
2: 3
3: 27
4: 335
931018046_931018050 2 Left 931018046 2:58008950-58008972 CCACAGAGAAGGAGGAATGTGGT 0: 1
1: 1
2: 0
3: 24
4: 297
Right 931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG 0: 1
1: 0
2: 3
3: 27
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931018050 Original CRISPR ACTCACAGGGAGAAGGTAGA AGG Intronic
900106450 1:983331-983353 ACCCACAGGGAGGAGGCACAGGG - Intergenic
900573188 1:3370000-3370022 TGTCACAGGGAGAAGAAAGAAGG + Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901207743 1:7506344-7506366 ACTCCCAGGGGGAAGGTTGGAGG + Intronic
901700784 1:11043934-11043956 ACACACAGGAAGGAGGAAGAAGG + Intronic
902388151 1:16087946-16087968 AGGCACAGGGAGGAGGGAGAGGG - Intergenic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
903381302 1:22898741-22898763 AGTGGCAGGGAGAAGGTAGTGGG + Intronic
903465780 1:23551984-23552006 ACTCACAGAGAGAACGTAACAGG + Intergenic
903680697 1:25094750-25094772 ACCCACAGGTAGAAGCCAGAGGG - Intergenic
905276970 1:36824699-36824721 GCCCAGAGGGAGAAGGCAGAGGG + Intronic
905872902 1:41415257-41415279 TCTCACAGGGAGAAGCAGGAAGG - Intergenic
909852869 1:80490946-80490968 ACTGACAGGCAGAAGCTACATGG + Intergenic
911493205 1:98595086-98595108 ACTCACAGAGATACAGTAGAAGG - Intergenic
911499860 1:98672461-98672483 GCTCACAGGAAGAAAGAAGAGGG + Intronic
911614478 1:99993446-99993468 ACCGAGAGGGAGAAGGGAGAGGG - Intronic
911639362 1:100270538-100270560 ACTCCTAAGGAGAAGGCAGAAGG - Exonic
912629961 1:111238443-111238465 ACTCAAAAGGGGAAGGAAGATGG + Intronic
913389248 1:118292028-118292050 ACTCACAGGGAAGAAGCAGAAGG - Intergenic
915643231 1:157246128-157246150 AGTCACAAGGTGAAGGCAGAAGG - Intergenic
916662378 1:166934637-166934659 ATTGACTGGAAGAAGGTAGAAGG - Intronic
917745071 1:177998844-177998866 TCTCTCAGGGTGAATGTAGAGGG - Intergenic
918207727 1:182324359-182324381 AGTCCCAGGGAGAAGGGAAAGGG + Intergenic
918575215 1:186050351-186050373 AATCACTTGGAGAAGGTAAAAGG + Intronic
918867293 1:189919151-189919173 ACCCACAGGCTGAAGGTAAATGG - Intergenic
919310933 1:195907877-195907899 ACTCTCAAGGAAAAGGTAGCAGG + Intergenic
919931768 1:202225745-202225767 ACTCCCAGGGAGAAGTTAGGAGG - Intronic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
922663446 1:227449452-227449474 ACTGACGGGCAGAAGGCAGAAGG + Intergenic
923071150 1:230565491-230565513 ACTCACTGGGAGAAGCTGGGAGG + Intergenic
923247638 1:232148178-232148200 AGCCACAGGGAGAAGGTAACTGG - Intergenic
923282635 1:232459619-232459641 ACTCAGAAGGGGAAGGTAGGAGG - Intronic
924679276 1:246215588-246215610 ACTCTGTGGGAGAAGGCAGATGG - Intronic
924705233 1:246495841-246495863 ACTCAGAGGGCGGAGGTAGGCGG + Intronic
1062814444 10:489441-489463 ACTGACAGGCAGAAGCTAGCTGG + Intronic
1062929638 10:1344461-1344483 ACTTACAGAGGGAAGGTAAAAGG + Intronic
1063640287 10:7823002-7823024 ACTCAGAAGGTGAAGGTAGGAGG + Intronic
1063914963 10:10872114-10872136 ACCCACATGGGGAAGGTTGAGGG - Intergenic
1063980753 10:11449798-11449820 ACTCACTGGCACATGGTAGATGG + Intergenic
1064135209 10:12744790-12744812 ACTCACGAGGATAAGGGAGAAGG + Intronic
1064642592 10:17429512-17429534 ACACACAGGGAGAAAGTGAAAGG - Intronic
1064797414 10:19028818-19028840 GCCCACAGGGAGGAGGTACAGGG - Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066165234 10:32780484-32780506 AATGACAGGGATAAGTTAGAGGG + Intronic
1068738992 10:60447699-60447721 ATTCACAGGAATAAGGTAGAGGG - Intronic
1069065984 10:63942310-63942332 ACTGAGAGGGAGAAGGAAAATGG - Intergenic
1069186713 10:65431979-65432001 ATTGACAAGGAGAAGGTAGTTGG + Intergenic
1070711312 10:78685278-78685300 TCCAACAGGGAGAAGGTAGAGGG - Intergenic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071799601 10:89043825-89043847 GCTTACAGGGAGAGGGTAGGTGG - Intergenic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1078863472 11:15275191-15275213 ACTCTCAGCTATAAGGTAGAAGG - Intergenic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1080076504 11:28156608-28156630 ATTCCCAGGGAGAAGGGAAAGGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080852682 11:36084025-36084047 ACTCACAAGGCTGAGGTAGAAGG - Intronic
1081981184 11:47268339-47268361 ACTCACATGGGGATGGTGGATGG - Exonic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1084573682 11:69975360-69975382 ACTCACAGGGAGGGCGTAGTAGG - Intergenic
1084805253 11:71574155-71574177 CCTCACAGGGAATAGGTAGTGGG + Intergenic
1085094562 11:73749353-73749375 ACTCACAGGGAAGTGGGAGAGGG + Intronic
1085930736 11:81080056-81080078 AACCAGAGGGAGGAGGTAGAGGG - Intergenic
1087350555 11:97026597-97026619 ACTCTCAGAGATAGGGTAGAAGG + Intergenic
1087806564 11:102561899-102561921 AATCACAAGGAGCAGGAAGAGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089780358 11:120869422-120869444 GGGCACAGGGAGCAGGTAGAAGG - Intronic
1090596418 11:128325332-128325354 CTTCTGAGGGAGAAGGTAGATGG + Intergenic
1091077405 11:132633394-132633416 ACAAACAGGGAGAAAATAGATGG + Intronic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1091351880 11:134904308-134904330 AATCACAGTGAGGAGCTAGAGGG - Intergenic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1093966751 12:25335828-25335850 AATCACAGGGTGAAGGCACAGGG + Intergenic
1094706156 12:32916110-32916132 ACTCACAGGGGGAAGGAACTTGG + Intergenic
1095237392 12:39813754-39813776 ACTCACATTGAGATTGTAGATGG - Intronic
1096400339 12:51300875-51300897 ATTCAGAGGAAGAAGTTAGAAGG - Intronic
1096546796 12:52345657-52345679 TCTCACAGGCAGGAGGAAGAGGG + Intergenic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1099520012 12:83648909-83648931 AGACACAGGGAGAAGGTGGCTGG - Intergenic
1101182561 12:102235304-102235326 ATTGACAGTAAGAAGGTAGAAGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1102955055 12:117053810-117053832 ACTGACAGGAAGATGGTACAGGG - Intronic
1104797859 12:131532143-131532165 GCTCACAGGTAGAAGATGGAGGG - Intergenic
1107757729 13:43643250-43643272 ATTCACAGCCAGGAGGTAGACGG - Intronic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1111303675 13:86378178-86378200 ATGCACAAGGAGAAGATAGATGG + Intergenic
1111992690 13:95132870-95132892 ACTCAGAGACAGAAAGTAGAAGG + Intronic
1112523035 13:100115231-100115253 ACTCATAGAGAGAGAGTAGAAGG + Intronic
1112601397 13:100858976-100858998 ACACACAGGGAGAAGGCAAGGGG + Intergenic
1113355556 13:109576580-109576602 ACAGAAAGGGAGGAGGTAGAAGG + Intergenic
1113356939 13:109589888-109589910 ACTCACTGGAAGAAGGAAAAGGG + Intergenic
1113651656 13:112037485-112037507 ACTCGCACGGGGAAGGGAGAAGG - Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114718744 14:24857257-24857279 AATAACAGAGAGAAGGCAGAGGG + Intronic
1115046493 14:29001100-29001122 AGTCACATGAGGAAGGTAGAAGG + Intergenic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1116565110 14:46434993-46435015 ACTAACAGTGAAAAGATAGAAGG + Intergenic
1116582344 14:46658624-46658646 ACTCTCAGGGAGAAGTGTGAAGG + Intergenic
1116860744 14:49993787-49993809 GCCCCAAGGGAGAAGGTAGAAGG + Intronic
1117838220 14:59829681-59829703 TCACACAGGGAGCAGGCAGAGGG + Intronic
1118176227 14:63442584-63442606 ACACAGAGAGAGAAGGAAGAGGG + Intronic
1120401499 14:84038299-84038321 ACTAATAGGAAGAAGATAGAAGG + Intergenic
1122173443 14:99897323-99897345 ACTCAGAAGGCGAAGGTAGGAGG + Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1124891794 15:33740523-33740545 AATTACAGGGAGAAAGTAAAAGG - Intronic
1127040539 15:54970832-54970854 ACTCACAGAAATAAAGTAGAGGG + Intergenic
1128210605 15:65898353-65898375 ATAAACTGGGAGAAGGTAGAAGG + Intronic
1128704827 15:69831376-69831398 TCTTCCAGGGAGAAGGCAGAGGG - Intergenic
1132007917 15:98247499-98247521 ACTCACAGGCTCAAGGTAAAGGG - Intergenic
1133037516 16:3042253-3042275 ACTCACAGGGCTAAGGCAGGAGG + Intergenic
1133187283 16:4109054-4109076 AGTCACTGGGAGAAGGTTGCAGG - Intronic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1137758672 16:50922844-50922866 ACTCAGAGTGGGAAGGAAGAGGG + Intergenic
1138101314 16:54254346-54254368 AGTCACAGGGAGAAGGAACAGGG + Intronic
1138980053 16:62257296-62257318 ACAGACAGGGAGACGGGAGAAGG - Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140879643 16:79186446-79186468 ACACACAGGGAGAAGGCCGTGGG - Intronic
1141126312 16:81403614-81403636 AGTCACAGGGAGAAGGTGGCCGG - Intergenic
1143014728 17:3885590-3885612 ACTCACTTGGAGGAGGCAGATGG - Exonic
1143734262 17:8899364-8899386 AGTCACAGGGAGAAATGAGAAGG - Intronic
1144201897 17:12949287-12949309 GCTCACAGGGAAGGGGTAGAGGG + Intronic
1145064182 17:19750888-19750910 ACTCAAGGAGAGTAGGTAGAGGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146801167 17:35824129-35824151 GGTCACAGGGAGGAGGTAGAGGG + Exonic
1146846510 17:36184499-36184521 GCACACAGCGTGAAGGTAGAAGG - Intronic
1148553221 17:48563185-48563207 GCACACAGGGAAAGGGTAGAGGG + Intronic
1149849862 17:60027896-60027918 GCACACAGTGTGAAGGTAGAAGG - Intergenic
1149860306 17:60118628-60118650 GCACACAGTGTGAAGGTAGAAGG + Intergenic
1150589663 17:66551169-66551191 ACTCACAGGGCTAAGGTGGGAGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151721961 17:75862105-75862127 ACACGCAGGGAGAAGGCAGGCGG + Intergenic
1151934207 17:77251862-77251884 AACCACAGGGAGAAAATAGACGG - Intergenic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1153000505 18:451172-451194 ACTGACAGGGAGCAGGCAGGAGG - Intronic
1153725174 18:7946961-7946983 ACTCACAGGATGGAGGGAGAGGG - Intronic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155296933 18:24393390-24393412 AGTCACAGCCAGAATGTAGAAGG + Intronic
1155524423 18:26702068-26702090 ACTTACATTGAGAAGGAAGAGGG + Intergenic
1156393292 18:36673567-36673589 ACTCCCAGAGAGCAGGCAGAGGG + Intronic
1156534572 18:37850172-37850194 ACAAAGAGGGAGAGGGTAGAAGG - Intergenic
1158201557 18:54947313-54947335 GCTCCCAGGGAGGAGGCAGAGGG + Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1160465657 18:79073672-79073694 ACGGAGAGGGAGAAGGGAGAGGG + Intronic
1163316041 19:16541487-16541509 ACCCACAGGGAGACGGCAAAGGG + Intronic
1163583452 19:18151860-18151882 ACTCGCAGGGAGAGGGTAGCAGG - Intergenic
1164010170 19:21195302-21195324 ACTCACAGAGAGAAGTTACCAGG - Exonic
1164732156 19:30514459-30514481 ACTCACAGGGAGATGAGAAATGG + Intronic
1168375720 19:55877724-55877746 AGACACAGGGAGAAGACAGATGG - Intronic
1168675897 19:58277920-58277942 ACCCACAGGGAGAAGCAATAGGG + Intronic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
926761045 2:16279400-16279422 TCTGACAGGGATAAGGGAGAAGG + Intergenic
927746379 2:25625688-25625710 ACTCAGAAGCAGAAGGTACAAGG - Intronic
927750486 2:25665283-25665305 ACTGACAGGGAGATGGTGGGAGG - Intronic
929282672 2:40099541-40099563 ACTGACAGGGGGCAGGTAGAAGG - Intronic
930165941 2:48203981-48204003 ACTCAGAGGGCTAAGGCAGAAGG + Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932976777 2:76611917-76611939 ATTCACAGTGAGGAAGTAGAAGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
936068274 2:109348366-109348388 GCTCACAGGGAGATGATAGCTGG + Intronic
938108628 2:128549924-128549946 GGGCACAGGGAGGAGGTAGATGG - Intergenic
939870424 2:147520478-147520500 ACTCACAGGGAGAAGAGGGCTGG - Intergenic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940738176 2:157477679-157477701 AAATACAGAGAGAAGGTAGAAGG + Intronic
940876650 2:158904413-158904435 ACTAACAGGGACAAGGCTGAAGG - Intergenic
941318978 2:164031103-164031125 ACTGACAGGGTGAAGGTTAAGGG + Intergenic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
941576109 2:167232388-167232410 ACTCAAAGAGAGAAGGAAAAAGG - Intronic
941688345 2:168470614-168470636 ACACACTGGGTGAAGGCAGAAGG - Intronic
942687193 2:178545751-178545773 AATCAGGGGGAGAAGGGAGAAGG - Intronic
943049812 2:182900942-182900964 AGTCAAGGAGAGAAGGTAGAAGG - Intergenic
944237382 2:197452912-197452934 ACACGCAGGAAGAAGGCAGACGG + Intergenic
945702784 2:213191808-213191830 AGACATAGGGAGAAGGTAAAAGG - Intergenic
946064169 2:216972184-216972206 AAACACAGGGAAAAGGAAGATGG + Intergenic
946149103 2:217752440-217752462 ACACACAGAGAGAAGGCAGCAGG + Intronic
946484157 2:220084829-220084851 ACTCTTAGGGACAAGGAAGATGG - Intergenic
947158499 2:227187813-227187835 ATAAACAGAGAGAAGGTAGAAGG - Intronic
1169191738 20:3662433-3662455 ACACACAGGGAGATGGATGAGGG - Intronic
1170704187 20:18729869-18729891 ACTCAGAGAGAGAAGGAAGAAGG - Intronic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1171255002 20:23684030-23684052 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171262356 20:23745957-23745979 ACACACAAGGAGATGGTTGAGGG + Intergenic
1171271453 20:23821675-23821697 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171275627 20:23854755-23854777 ACACACAGGGAGAAGTTGGGGGG + Intergenic
1171304297 20:24092004-24092026 ACTCACAGGGAGAAAGAATTTGG + Intergenic
1172702025 20:36859590-36859612 TCTCCCAGTGAGAAGATAGAAGG - Intronic
1173566511 20:44042462-44042484 ACTCCAAGGGAGAAGTTAAAGGG + Intronic
1174590008 20:51637455-51637477 ACCCACAGGGAGAAGACAGGTGG + Intronic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1179718402 21:43301874-43301896 AATCACAGGGAGATGGTGGCTGG + Intergenic
1182255441 22:29034375-29034397 ACTCACAGGTGGAAGGCTGAAGG - Intronic
1182392226 22:30008055-30008077 ACTCACAAGGAGAAAGTATGGGG - Intronic
1183264775 22:36818435-36818457 ACTCACAGGGAGGGGGCAGCTGG - Intronic
1184767707 22:46580190-46580212 AGTAACAGGCAGAAGGCAGAGGG + Intronic
1184804454 22:46784152-46784174 ACTCACAAGGCTAAAGTAGATGG - Intronic
1185180856 22:49362035-49362057 AATCACAGAGAGAGGGAAGAGGG + Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949614669 3:5739740-5739762 ACTCATAGGAACAAGGAAGAGGG - Intergenic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
951698637 3:25471933-25471955 CCTGACAATGAGAAGGTAGAGGG - Intronic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952750290 3:36819520-36819542 ATTCACAGAGACAAAGTAGAAGG + Intergenic
953134943 3:40174307-40174329 ACTCACAGGGAGAGGACAGGAGG - Intronic
953399251 3:42598691-42598713 ATTTACAGAGAGAAAGTAGAAGG + Intronic
953540841 3:43816776-43816798 ACACACAGGGAGAAGTTTGCTGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956892897 3:73629761-73629783 ACTTACATGGAGCAGGAAGAGGG - Intergenic
956985375 3:74693214-74693236 ACTTCTAGGGAGAAGGTAGGTGG + Intergenic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
959919026 3:111850288-111850310 ACTCAAAGGGAGAAGGTGAGGGG + Intronic
960337645 3:116437567-116437589 ATTTACAGGGAGAAGAGAGAGGG + Intronic
961088861 3:124092682-124092704 ACTCTCAGGGAGGAGACAGATGG + Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963224371 3:142846728-142846750 ACTCACAGGTAGATGGGAGATGG - Intronic
963587358 3:147209250-147209272 AATCAAAGGGAGAAAGAAGAGGG - Intergenic
964392942 3:156216273-156216295 ATTTATAGGGAGGAGGTAGATGG + Intronic
964453799 3:156838561-156838583 ACCAACTGGGAGAAGGAAGAAGG + Intronic
965991325 3:174822164-174822186 ACACACAGGGCGGAGGGAGAGGG + Intronic
968582367 4:1401051-1401073 CCCCACAGGGAGATGATAGAAGG - Intergenic
969092444 4:4705091-4705113 AGACACAGGGAGAAGATGGATGG + Intergenic
970034396 4:11716071-11716093 ATTCACCTGGAGAAGGGAGAGGG - Intergenic
970339340 4:15088049-15088071 ACTCACTGGAAGAAAGGAGAAGG - Intergenic
970510352 4:16776087-16776109 ACTCCCAGGGAGATGGAAGGGGG - Intronic
971018581 4:22512622-22512644 ACACACAGGGAGAAGGCCAATGG + Intronic
971869809 4:32220078-32220100 ACTACCAGAGATAAGGTAGAAGG + Intergenic
972103836 4:35457479-35457501 AAGCACAGGGAGGAGTTAGAGGG + Intergenic
973968429 4:56186955-56186977 ACTCACAGGGAGACTGAAGTGGG + Intronic
975395903 4:73872965-73872987 AGTCACAGGGTGAAGGAAGTAGG + Intergenic
976230492 4:82837731-82837753 AATCACTGGGGGAAGGAAGAGGG + Intronic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
978431497 4:108637394-108637416 ACTTTCAGGGAGAAGGAATAGGG + Intergenic
978702815 4:111669916-111669938 ACTTCTAGAGAGAAGGTAGAGGG - Intergenic
980589966 4:134873648-134873670 ACTGACAGAGAGAAGGTAGATGG + Intergenic
981023125 4:140049487-140049509 ACTCACAGGGAGAACAGAGGAGG + Intronic
982949905 4:161680723-161680745 TCTCACAGGGAAAATTTAGAAGG - Intronic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985277691 4:188254495-188254517 ACGCACAGGGAGAACGTTTATGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
986055980 5:4136981-4137003 ACTCTCAGGGATAAGGTTCATGG + Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
986741203 5:10707022-10707044 ACCCACATGGAGAAGTCAGAGGG + Intronic
988903282 5:35756776-35756798 TCTCCCAGGGAGAGGGAAGAAGG - Intronic
991673957 5:69074573-69074595 ACTCGAAGGGTGAAGGAAGATGG + Intergenic
992180193 5:74188508-74188530 ACTCACATGGTGAACGTAGGTGG + Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992767111 5:80011444-80011466 ACTAAAAGGAAGAAGGGAGAAGG + Intronic
993163931 5:84326807-84326829 TCTCAAAGAGAGAATGTAGAAGG - Intronic
993439620 5:87939648-87939670 ACACACAGAGACGAGGTAGAAGG + Intergenic
993634371 5:90326250-90326272 ACTCACAGGGAGGAGAGACAGGG + Intergenic
994363599 5:98884500-98884522 ACTCAGAGGGAAAGGGTAGGAGG + Intronic
996621104 5:125504214-125504236 ACTCACAGTAAGACAGTAGAGGG + Intergenic
998408066 5:141885766-141885788 ACTTCCAGGAAGAAGGGAGAGGG - Intergenic
998970088 5:147581559-147581581 ACTCACTGAGAGATGTTAGATGG - Intergenic
999633865 5:153599932-153599954 AGTCACAGGGGAAAGGAAGAAGG + Intronic
999647406 5:153731931-153731953 ACTTACAGGAAGAGAGTAGAAGG - Intronic
999654676 5:153800178-153800200 GCTCAGAAGGAGTAGGTAGAGGG - Intronic
1000345618 5:160311713-160311735 ACACTCCGGGAGAAGGTAAAGGG + Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001698960 5:173692790-173692812 ACTCACAGGGAGAAGAGAACAGG - Intergenic
1005377402 6:25197827-25197849 ACTCACAGGTAGAAATTACATGG - Intergenic
1005692882 6:28324028-28324050 GCTCACAGGGTGAAGGGAAAGGG - Intergenic
1007278484 6:40692908-40692930 AATCACAGGGAGAAGGTGATGGG + Intergenic
1007616300 6:43181687-43181709 ACGCACAGGGAGAAGGTCCTCGG - Intergenic
1008402540 6:51080172-51080194 ACTGATAGGAAGAAAGTAGAAGG + Intergenic
1008457664 6:51729447-51729469 ACTCAGAGGGAAAAACTAGAAGG - Intronic
1008641501 6:53467227-53467249 ACTCACAGAGATAGAGTAGAAGG - Intergenic
1009533403 6:64849980-64850002 ACTCACAGGGAGAAGATTACAGG + Intronic
1009925376 6:70114302-70114324 CCTCACAGTGAGAAGGATGATGG - Intronic
1010258081 6:73783158-73783180 AGTCACAGGGAGAAGGGGCATGG + Intronic
1010891640 6:81319878-81319900 CCTCACTGGAAGAAAGTAGAAGG - Intergenic
1011008925 6:82681694-82681716 AGTCACAGGAAGGAGGAAGAAGG + Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012547498 6:100436152-100436174 ACTCACAATTAGAAGGAAGAGGG - Intronic
1012665408 6:101962119-101962141 AGTCCCATGGATAAGGTAGATGG - Intronic
1013254556 6:108371491-108371513 ACTCACAAGGCTAAGGCAGAAGG - Intronic
1013605820 6:111746801-111746823 ACAAACAGAGAGAGGGTAGAGGG + Intronic
1013727702 6:113120052-113120074 TCTCATAGCTAGAAGGTAGAAGG - Intergenic
1013956733 6:115850946-115850968 AGTCACACTGAGAAGCTAGATGG + Intergenic
1014022603 6:116608306-116608328 ACTCACAGGCTCAAGGTAAAGGG + Intergenic
1016393327 6:143596951-143596973 AGACACAGGCAGAAGGCAGATGG - Intronic
1016518222 6:144921015-144921037 ACTCAGAGGGAAAATGGAGAAGG + Intergenic
1016874949 6:148855391-148855413 ACTCACAGAAAGCAGGTAGTGGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018476625 6:164148899-164148921 ACTAAAAGGAAGAGGGTAGAGGG + Intergenic
1018863642 6:167731351-167731373 ACTCACCGGAAGAGGGAAGAAGG + Intergenic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1020500317 7:8910733-8910755 AGACACAGGGAGAAGATAGCTGG + Intergenic
1020913100 7:14158306-14158328 TGCCACAGGGAGAAGGCAGATGG - Intronic
1022533101 7:31079243-31079265 ACTCACAGGGATGGGGTAGAAGG - Intronic
1022891164 7:34701269-34701291 ACTCCCAGGGAGAGGATATATGG - Intronic
1023370626 7:39508996-39509018 TCCCTCAGAGAGAAGGTAGAGGG - Intergenic
1024324979 7:48102339-48102361 ACTCACTGTGAGGTGGTAGAGGG - Intronic
1024866764 7:53912095-53912117 ACACACATGGAGAAGGTGGTGGG - Intergenic
1025921498 7:65917255-65917277 ACGCACAGAGAAAAGGTGGAGGG - Intronic
1026345008 7:69466152-69466174 ACTCATATGGTGAAGGCAGATGG - Intergenic
1028178873 7:87692346-87692368 ACTCACAAGGCGAAGGCAGGAGG + Intronic
1028985489 7:97005719-97005741 ACTCAAAGGGAGGAGGAAGGAGG - Exonic
1031284596 7:119849291-119849313 AGTGACAGAGAGATGGTAGAAGG - Intergenic
1031304073 7:120102036-120102058 ACTTCCAGGGAGAAGAAAGACGG - Intergenic
1032438987 7:131927426-131927448 AGTGACAGGGACAAGGCAGAGGG - Intergenic
1034405428 7:150899575-150899597 ACTCACGGGTAGATGGCAGAGGG - Intergenic
1034488970 7:151382785-151382807 GCTCACAGGGAAATGGGAGATGG + Intronic
1034509584 7:151522783-151522805 ACACACAGAGAGAAGGCAGCAGG - Intergenic
1035072144 7:156153557-156153579 ACTAACAGGGAATAGGTGGAAGG + Intergenic
1036497015 8:9278783-9278805 ACCCACAGGGAGAAACTAAAAGG - Intergenic
1036577894 8:10045391-10045413 AATCCCAGGGAGAAGAAAGAAGG + Intergenic
1037591738 8:20318080-20318102 AATCACAGAGAGAAGGAAGAGGG - Intergenic
1038621248 8:29145073-29145095 AGTCACAAGGAGAAGGTTCAGGG - Intronic
1039143329 8:34417527-34417549 ACTCAAAGGGAGAAGGTCAGTGG - Intergenic
1039301381 8:36212614-36212636 ACACACAGGGAGAAAAAAGAGGG - Intergenic
1039765654 8:40625436-40625458 ACAGTCAGGGAGAAGGTTGAAGG + Intronic
1039908715 8:41807474-41807496 ATTCACAGGAAGAAGGTGAAAGG - Intronic
1041568917 8:59313617-59313639 GCACACAGGGAGAAGAGAGAGGG - Intergenic
1042377117 8:68064475-68064497 ACTCACAAGGCTAAGGTAGGAGG - Intronic
1042395492 8:68287037-68287059 ATTGACAGGGAGAAGATTGAAGG - Intergenic
1043141879 8:76600800-76600822 TCTCAGAGGGAGAAGGTATTGGG + Intergenic
1043964169 8:86453224-86453246 ACTCACAGAAACAAAGTAGAAGG - Intronic
1044021955 8:87115865-87115887 ATGCACAGTGAGAAGGTAAACGG - Intronic
1044641518 8:94387382-94387404 ACTTGCAGGGTGAAGGTAGCAGG - Intronic
1044737723 8:95296366-95296388 ACTTGCAGGGAAAAGGTGGAAGG + Intergenic
1045212813 8:100116292-100116314 GCTCACATCGAAAAGGTAGAAGG + Intronic
1046778097 8:118185385-118185407 ACTCTCAGTGGGAAGGGAGAAGG - Intergenic
1047175706 8:122538365-122538387 ACTCACAGGCAGAGGTGAGAGGG + Intergenic
1047197557 8:122735237-122735259 ACACACAGGGAGAGGGAGGAAGG - Intergenic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1052862018 9:33443171-33443193 ACGCACAGGGTCAAGGTAGGGGG - Intronic
1053601853 9:39618892-39618914 AGTCACTGGGAGAAGGTAGGGGG - Intergenic
1053859505 9:42372659-42372681 AGTCACTGGGAGAAGGTAGGGGG - Intergenic
1054251682 9:62723535-62723557 AGTCACTGGGAGAAGGTAGGGGG + Intergenic
1054565794 9:66758052-66758074 AGTCACTGGGAGAAGGTAGGGGG + Intergenic
1054781815 9:69173179-69173201 GCTCACAAGTAGAAGGTAAAAGG - Intronic
1055197623 9:73615570-73615592 CCTTCCAGGGAGAAGGTACAAGG + Intergenic
1055221288 9:73935448-73935470 ACTCAGAAGGCTAAGGTAGAAGG - Intergenic
1055294567 9:74820953-74820975 AAGCAGAGGGAGATGGTAGAGGG + Intronic
1056363550 9:85881874-85881896 ACTGACACGGAGAAGGGAGTGGG - Intergenic
1056984498 9:91349698-91349720 ACACACAGAGAGAAGAGAGAGGG + Intronic
1057201826 9:93144582-93144604 ACTTGCAGGGAGAAGGAAGAAGG + Intergenic
1057320695 9:94010057-94010079 ACTCAAATGGAAAAGCTAGACGG - Intergenic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1058320696 9:103627033-103627055 ACTAACAGGTAGAAGGTTGAAGG + Intergenic
1059902075 9:118939158-118939180 ACTGCCAGGGAAAATGTAGAGGG + Intergenic
1060819773 9:126654637-126654659 AGTCACTGGGAGAAGACAGAGGG - Intronic
1061512569 9:131069970-131069992 GGGCACAGGGAGAAGGTAGGTGG - Intronic
1185964708 X:4587508-4587530 ACGGACAGAGAGAAGATAGATGG + Intergenic
1186080124 X:5922052-5922074 AATCAGAGGGAAAAGGGAGAAGG + Intronic
1186307113 X:8273712-8273734 ACTCACAGGGACCAGTTTGAAGG - Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1189683460 X:43540118-43540140 ACACACAGAGGAAAGGTAGAAGG + Intergenic
1190567683 X:51747405-51747427 ACACAAAGGGACAATGTAGAAGG - Intergenic
1193780994 X:85701249-85701271 TCTCTCAGGGAGAAGGAGGAGGG - Intergenic
1196296806 X:114006977-114006999 ACTTACAGTGAGAACGCAGAAGG + Intergenic
1196481318 X:116153203-116153225 ACTCACAGAGAGAGAATAGAAGG + Intergenic
1196510077 X:116499217-116499239 AGCCACAGGGAGAAAGGAGAGGG - Intergenic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1199476404 X:148250898-148250920 ACCCATAGGGATAAAGTAGAAGG - Intergenic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic