ID: 931021342

View in Genome Browser
Species Human (GRCh38)
Location 2:58047416-58047438
Sequence AGGGAAACGACAGCCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931021342_931021345 -7 Left 931021342 2:58047416-58047438 CCCTGAGAGGCTGTCGTTTCCCT 0: 1
1: 0
2: 0
3: 11
4: 120
Right 931021345 2:58047432-58047454 TTTCCCTTGGCAGATGAACTCGG 0: 1
1: 0
2: 1
3: 13
4: 207
931021342_931021346 -6 Left 931021342 2:58047416-58047438 CCCTGAGAGGCTGTCGTTTCCCT 0: 1
1: 0
2: 0
3: 11
4: 120
Right 931021346 2:58047433-58047455 TTCCCTTGGCAGATGAACTCGGG 0: 1
1: 0
2: 0
3: 13
4: 115
931021342_931021349 7 Left 931021342 2:58047416-58047438 CCCTGAGAGGCTGTCGTTTCCCT 0: 1
1: 0
2: 0
3: 11
4: 120
Right 931021349 2:58047446-58047468 TGAACTCGGGACTCGCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931021342 Original CRISPR AGGGAAACGACAGCCTCTCA GGG (reversed) Intronic
902347757 1:15831316-15831338 AAGGAAAGAACAGCTTCTCAAGG - Intergenic
903586813 1:24422224-24422246 GGGGAAACAACAGGCTTTCATGG - Intronic
907784507 1:57598597-57598619 AAGGAAAAGACACCCTCCCAAGG + Intronic
912507289 1:110165099-110165121 AGAGAAACGGCTGCCTGTCAAGG - Intronic
912548002 1:110465250-110465272 ACGGAAATGACTGCCTTTCAAGG - Intergenic
913307798 1:117450873-117450895 AGGGACACGACTCTCTCTCATGG + Intronic
915273626 1:154773173-154773195 AGGGGAACGACAGACACTGAGGG - Intronic
917488410 1:175476246-175476268 AGGAAAACCACAGGCTCTCTGGG + Intronic
918374329 1:183893723-183893745 AGAGAAATGACAGCTTCTCCTGG - Intronic
924560877 1:245155818-245155840 AGGTAAACGAGAGGCTCTCACGG - Intronic
1063612815 10:7577080-7577102 AAGGAAACTGCAGACTCTCAGGG + Intronic
1065385075 10:25126092-25126114 AGGGAAAAGACACCCTCACATGG - Intergenic
1071723384 10:88170094-88170116 ATGGAAAAGACTGCCCCTCATGG + Intergenic
1072159256 10:92751061-92751083 AGGGAAATGACACTCTCCCAAGG + Intergenic
1072683433 10:97522913-97522935 AGGGAGATGAAAGCCTCTAAAGG - Intronic
1074584065 10:114749621-114749643 AGTGAAACGACAACCACTCAAGG - Intergenic
1076465655 10:130679774-130679796 AGGGAAGCAAGTGCCTCTCATGG - Intergenic
1076573771 10:131450410-131450432 AGGAAAGCGACTGGCTCTCATGG - Intergenic
1077904090 11:6515624-6515646 AGGGAAACAAGAGCCTCTACAGG - Intronic
1081654213 11:44846727-44846749 AGGGGAAATACAGCCTCTCCAGG + Intronic
1084214614 11:67640612-67640634 AAGGAACTGGCAGCCTCTCAGGG - Intergenic
1088446614 11:109937047-109937069 AAGGAAGCCACAGCCTCTTAAGG - Intergenic
1097199793 12:57268853-57268875 AGGAAAAGGAGAGCCTCCCAGGG - Intronic
1097311331 12:58122509-58122531 AGAGAAGCGCCAGCCCCTCAGGG + Intergenic
1097910700 12:64966141-64966163 TGGGAAACCACACTCTCTCATGG - Intergenic
1102831747 12:116008585-116008607 AGGCCAAAGACTGCCTCTCATGG - Exonic
1109725240 13:66332037-66332059 AGGGAGATGACAGCGACTCAAGG + Intronic
1117712069 14:58541163-58541185 AGAGAAACCACAGACTCTCTAGG + Intronic
1119223201 14:72925704-72925726 AGGAAAACGGAAGCCTCTGATGG - Intergenic
1119997398 14:79268600-79268622 AAGAAAACGTCAGCCTCTTAAGG + Intronic
1121211023 14:92207950-92207972 AGGCAAACCTCGGCCTCTCAAGG + Intergenic
1123476297 15:20594279-20594301 AGGAACACGACAGCTTCCCAGGG - Intergenic
1123641715 15:22406085-22406107 AGGAACACGACAGCTTCCCAGGG + Intergenic
1123922967 15:25083498-25083520 AGGGATACAACAGCCTCCAAAGG - Intergenic
1124349871 15:28947397-28947419 AGAGAACGCACAGCCTCTCAAGG - Intronic
1128562089 15:68675398-68675420 AGGGAAAGTAAAGCCTCTGAGGG + Intronic
1141444606 16:84049911-84049933 AGGGCCACGACATCCTCTCCAGG + Intergenic
1141482279 16:84314441-84314463 TGGGAACCCACAGCCTCTCGTGG - Intronic
1141708118 16:85680740-85680762 AGGGAAAGGACAGACTTACAGGG + Intronic
1141855194 16:86676574-86676596 AAGGAAACGCCATCCTCTCCTGG + Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143642867 17:8209445-8209467 AGGGAACAGACAGACTCTCCAGG + Intronic
1144624825 17:16839277-16839299 AGGGAGACGTCAGCCTCCAACGG + Intergenic
1144744694 17:17606263-17606285 CTGGAAACCACAGCTTCTCAAGG + Intergenic
1144881605 17:18433444-18433466 AGGGAGACGTCAGCCTCCAACGG - Intergenic
1145150628 17:20510942-20510964 AGGGAGACGTCAGCCTCCAACGG + Intergenic
1147578969 17:41617972-41617994 AGGGAGACGTCAGCCTCTGATGG + Intergenic
1147842922 17:43385379-43385401 AGTCAAACGACAGCCCCTCTTGG + Intergenic
1147976060 17:44248721-44248743 AGGGACAGGAGAGCCTCCCATGG + Exonic
1148323444 17:46770765-46770787 AGGGAAAGGAGAGACTCTCAAGG + Intronic
1149621342 17:58047542-58047564 AGGGGAAAGACAGCCTCAGATGG + Intergenic
1152786873 17:82252930-82252952 AGGGAGAGGCCAGCCTCTCGGGG - Intronic
1152905802 17:82970275-82970297 CTGGAAACTGCAGCCTCTCAGGG - Intronic
1155300960 18:24428278-24428300 AGCAAAACTACAGTCTCTCAAGG - Intronic
1157291207 18:46411172-46411194 AAGGAAACGACAGCCCCTTGGGG + Intronic
1160189106 18:76700309-76700331 TGGGAAGCGACAGCAGCTCATGG - Intergenic
1162974250 19:14199221-14199243 TGGGGAACGAGAGCCTCCCAGGG + Intronic
1164170164 19:22717786-22717808 AGGGAACTCACAGCCTCACAGGG + Intergenic
1166250393 19:41565383-41565405 AGGGTAAGGACTGGCTCTCAGGG - Intronic
1168455937 19:56508210-56508232 ACAGAAACCACACCCTCTCACGG - Intronic
925754783 2:7123010-7123032 TGGGATATAACAGCCTCTCAAGG + Intergenic
926789388 2:16555019-16555041 AGGGAACAGCCAGCCTTTCAGGG - Intronic
929521181 2:42652386-42652408 ACGTAAAAGACAGCCTTTCAGGG + Intronic
930642187 2:53864842-53864864 AGGGAAAAAACAGCCAGTCAGGG + Exonic
931021342 2:58047416-58047438 AGGGAAACGACAGCCTCTCAGGG - Intronic
933774775 2:85765374-85765396 AGGGTCACGACACCTTCTCAGGG + Intronic
935895241 2:107730065-107730087 AGTGAAACGCCAGCCTAACAAGG + Intergenic
936513496 2:113167344-113167366 CGGGCAAGGACAGCCTCCCAAGG + Intronic
937863352 2:126730416-126730438 AGGGTTACGGCAGCCTCTGATGG + Intergenic
941230358 2:162904272-162904294 AGGAAAACTACAGCTTCTGAAGG + Intergenic
942617715 2:177811636-177811658 AGGGAAAGGACTGCCTTGCATGG + Intronic
944398237 2:199294536-199294558 TGGGAAATGAAAGCCTCCCAAGG - Intronic
944923982 2:204444131-204444153 ATGGAAAGCACAGCCTCTCAGGG - Intergenic
946609191 2:221439738-221439760 CGAGAAAGGGCAGCCTCTCATGG + Intronic
946768561 2:223063304-223063326 AGGCAAAGAACAGCCCCTCAGGG + Intronic
947009075 2:225546393-225546415 ATGGAAAGGACATTCTCTCATGG - Intronic
1169211831 20:3770107-3770129 AGGGATACTACATGCTCTCAGGG + Intergenic
1173208264 20:41011746-41011768 GGGGAAACGAAACCCTTTCATGG + Intergenic
1175822747 20:61919293-61919315 GGGGCCACCACAGCCTCTCAGGG - Intronic
1178245071 21:30942750-30942772 AGGGAAACGGCAACATCTCTTGG - Intergenic
1178352839 21:31885189-31885211 AGGGAAATGAAAACCTTTCAAGG + Intronic
1179187880 21:39098528-39098550 AGGAAAAGGAGAGCTTCTCAGGG + Intergenic
1180076261 21:45464685-45464707 AGGGAAGCGGCAGCCTCTAGAGG - Intronic
1180580655 22:16832962-16832984 AGGGAGAAGACACCCTCTCCAGG - Intergenic
1183503351 22:38194472-38194494 AGACAAAGGACAGCCTCTGAAGG + Intronic
1185420103 22:50730431-50730453 AAAGAAAAGACAGCCTCTCATGG - Intergenic
952755415 3:36861567-36861589 AGGGATAAGCCATCCTCTCATGG - Intronic
952833472 3:37584932-37584954 AGGGGAAGGTCAGCCTCCCAAGG - Intronic
957460552 3:80513288-80513310 AGGGAAGATACTGCCTCTCAAGG + Intergenic
966439933 3:179933261-179933283 AGGAAATCGACAGCCAGTCATGG + Intronic
966972030 3:185052934-185052956 ATGGAATCGTCAGGCTCTCATGG + Intergenic
968666555 4:1825500-1825522 AGGGAAACATCAGCCTCGAAAGG - Intronic
968682246 4:1929201-1929223 AGGGCAACAAGAGCCTCCCATGG + Intronic
969307759 4:6335548-6335570 AGGGAAACGGGAGCCACTGAGGG + Intronic
970861121 4:20703694-20703716 AGGGAAATAAAAGCCTGTCAAGG - Intronic
970990877 4:22211711-22211733 AGTTAAAAGACAGCATCTCAGGG - Intergenic
971038665 4:22725093-22725115 AGGGAAACAACACACACTCAGGG - Intergenic
976116829 4:81736700-81736722 AGGGAGACTGCAGCCTCTCCTGG - Intronic
979655771 4:123191769-123191791 AGGAAAATGACAACCACTCATGG - Intronic
985615918 5:922051-922073 AGGGAGACCCCAGCATCTCAGGG + Intergenic
986095803 5:4553171-4553193 AGTGAAAAAGCAGCCTCTCATGG - Intergenic
986778634 5:11044144-11044166 AGGGAAAGGACCTCCTGTCACGG - Intronic
988477952 5:31604350-31604372 AGGGAACCAACTGCCACTCAGGG + Intergenic
990033501 5:51291136-51291158 AGGAAAGAGACAGCCTCTCATGG + Intergenic
991171022 5:63626019-63626041 AGGAAGAGGCCAGCCTCTCAGGG + Intergenic
991702154 5:69326451-69326473 AGGTAAAACACAGCCTCTCAAGG - Intronic
995752726 5:115470787-115470809 AGGGAAAATACTGCCTCTCTGGG - Intergenic
999425435 5:151484201-151484223 GGGGAGATGACAGACTCTCAGGG + Intronic
1000489175 5:161887677-161887699 AGGAAAATGACAGCTTCACAAGG + Intronic
1003422292 6:5969322-5969344 AGGAAAACAACAACCTCACAGGG - Intergenic
1004015654 6:11729498-11729520 AGGGAAAGGCCCTCCTCTCAGGG - Intronic
1004550807 6:16645418-16645440 AAGGAAACGAAAGCCCCACAAGG - Intronic
1005134473 6:22551973-22551995 AGGGTAACTAAATCCTCTCAAGG + Intergenic
1007255500 6:40525303-40525325 AGGCAAATTACAGCCTCTCAAGG + Intronic
1010897564 6:81383150-81383172 AGGCAAATGCCAGCCTCCCAAGG + Intergenic
1019010947 6:168842969-168842991 AGGGACACGCCGGCCTCACATGG - Intergenic
1031242140 7:119259457-119259479 AGGTAAACCACATCATCTCAGGG - Intergenic
1031993297 7:128211576-128211598 ATGGGAACGCCAGGCTCTCAGGG + Intergenic
1033860720 7:145623401-145623423 AGGGCATCAACAGCCTCTGAAGG + Intergenic
1035283434 7:157792018-157792040 AGGGGAAGGACAGGCTCTCCGGG - Intronic
1036826310 8:11978650-11978672 AGGTAAATGAGAGCCTCTCGGGG - Intergenic
1037023835 8:14007567-14007589 AGGTATACGACAGCCTCACTTGG - Intergenic
1038155023 8:24981007-24981029 GGGGACAGGACAGCCTCTCATGG + Intergenic
1038445434 8:27600684-27600706 AGGGCAACGAGAGCCACTCCAGG - Intronic
1042111639 8:65387498-65387520 AGGGCAAGGACAGCCTCTGGGGG - Intergenic
1043887048 8:85612853-85612875 AGGAAAAGGAAATCCTCTCAGGG + Intergenic
1045734627 8:105280424-105280446 AGGGAAAGGGCCTCCTCTCAAGG + Intronic
1049263265 8:141651384-141651406 AGGGTCACGGCAGCCTCTCCTGG - Intergenic
1052530282 9:29674363-29674385 AGAGATACAACAGCCTCTCCAGG + Intergenic
1056020351 9:82432887-82432909 AGGGATAAGACAGCCTCATAGGG + Intergenic
1057283339 9:93727998-93728020 AAGGAAATGACAGCAACTCATGG - Intergenic
1186863384 X:13695048-13695070 ATGGAATCTACAGCCTTTCAGGG + Intronic