ID: 931036626

View in Genome Browser
Species Human (GRCh38)
Location 2:58251478-58251500
Sequence CACGCCAGCCCCAGTCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931036621_931036626 -3 Left 931036621 2:58251458-58251480 CCAGCAAGTGCTCCTCCGGCCAC 0: 1
1: 2
2: 0
3: 14
4: 188
Right 931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG 0: 1
1: 1
2: 2
3: 14
4: 264
931036619_931036626 6 Left 931036619 2:58251449-58251471 CCGGCGGTACCAGCAAGTGCTCC No data
Right 931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG 0: 1
1: 1
2: 2
3: 14
4: 264
931036618_931036626 11 Left 931036618 2:58251444-58251466 CCACACCGGCGGTACCAGCAAGT No data
Right 931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG 0: 1
1: 1
2: 2
3: 14
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931036626 Original CRISPR CACGCCAGCCCCAGTCCCGG CGG Intergenic
903326080 1:22569314-22569336 TGAGCCAGCCCCAGTCCCCGTGG - Exonic
904004216 1:27355295-27355317 CACACCAGCCCCAGGACCTGGGG - Exonic
904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG + Intergenic
904751038 1:32741683-32741705 CCCGCCTCCCCCGGTCCCGGCGG - Intergenic
905235493 1:36543292-36543314 CACTCCAGCCCCAGCAGCGGTGG + Intergenic
905797850 1:40825571-40825593 CCCTCCAGCCCCAGACCTGGAGG - Intronic
907389569 1:54149384-54149406 CACCCCAGCCCCATTCTGGGAGG - Intronic
912508229 1:110171202-110171224 CAGGCCAGCCCCAGTCACCAGGG - Intronic
912799096 1:112710243-112710265 GACGCCAGCCACGGTCTCGGGGG + Exonic
913011847 1:114691260-114691282 CATGCCAGGCCCACTCCCCGAGG - Intronic
914753531 1:150550765-150550787 CACCCCAACCCCAATCCCTGAGG + Intronic
915586984 1:156849219-156849241 GACCCCAACCCCAGTGCCGGTGG - Intronic
915902520 1:159856685-159856707 CACCCCAACCTCAGTCCCTGTGG + Intronic
916507766 1:165443590-165443612 CAAGCCTGCCCCAGTCCCAAAGG + Intronic
916773494 1:167936528-167936550 CACACCAGCCTCAGTCCCCAGGG + Intronic
917130953 1:171741893-171741915 CAGGCCAGCGCCAGTACCTGAGG + Exonic
917231795 1:172845537-172845559 CACGTCAGCTCCAGGCCAGGGGG - Intergenic
917510611 1:175666421-175666443 CAGGCCAGCCTCAGGCCCTGAGG + Intronic
917817644 1:178725984-178726006 CCCGCCAGCCCCGGCCCCGGAGG + Intronic
922467730 1:225855806-225855828 CACTGCAGCCCCAGCCCCTGTGG + Intronic
1066333038 10:34445933-34445955 CACCGCAGCCCCAGTTCCAGGGG + Intronic
1067166813 10:43871703-43871725 TACTCCAGCCACTGTCCCGGGGG - Intergenic
1067853072 10:49768091-49768113 TCCACCAGCCCCAGTCCAGGTGG + Intergenic
1068103841 10:52590332-52590354 CACCCCACCCCCAGCCCCAGAGG - Intergenic
1069743998 10:70703380-70703402 CACACCAGGCCCAGTCCCATAGG - Intronic
1070570314 10:77636345-77636367 GTCGCCAGCCTCAGTGCCGGTGG + Intronic
1072555332 10:96510352-96510374 CTCACCAGCCCCAGGCCAGGAGG + Intronic
1073436617 10:103520760-103520782 CACGCCAACCCTAATCCCGCTGG - Intronic
1075502887 10:122993971-122993993 CACCCCAGCCCCAGCCCTGCCGG - Exonic
1075777473 10:124997909-124997931 TACACCAGCCCCAGTGTCGGAGG + Intronic
1076809326 10:132878507-132878529 CACGCCTGCCCCAGACCCCCAGG - Intronic
1076904247 10:133354459-133354481 GACACCAGCCCCAGGCCCTGGGG + Intergenic
1077014665 11:394260-394282 GCCGCCAGGCCCAGGCCCGGTGG + Exonic
1077424476 11:2467864-2467886 CACAGCAGCCCCAGTGCGGGTGG - Intronic
1077922944 11:6655407-6655429 CACGCCCGCCCGGGTCCCGCAGG + Intronic
1078053472 11:7987391-7987413 CACGCCAACCCCAGTCCCGGCGG + Exonic
1081967583 11:47178902-47178924 CACCCCCACCCCAGTCCCCGGGG - Exonic
1083540054 11:63506246-63506268 CACACCAGCCCCACTCCCGGTGG - Intronic
1083776231 11:64895487-64895509 CACGTCAGCCCCAGGCCCCCAGG + Intronic
1083880792 11:65547368-65547390 CACCCCAGCCCCACCCCAGGTGG + Intronic
1084204415 11:67583687-67583709 CCCGCCGGCCCCAGCCCCGGCGG - Exonic
1084598066 11:70128958-70128980 CAGGCCATCCTCAGTCCAGGTGG + Intronic
1085507412 11:77068188-77068210 CACCCCACCCCCAGACCCTGGGG - Intronic
1090399229 11:126438140-126438162 CCAGGCAGCCACAGTCCCGGGGG - Intronic
1091170561 11:133516436-133516458 GAGTCCAGCCCCAGCCCCGGCGG - Intronic
1093579209 12:20768467-20768489 CACGCCACCCCTAATCCCGCTGG + Intergenic
1102445438 12:112998704-112998726 CACTCCAGCCTCTGTCCCTGAGG + Intronic
1103555117 12:121761610-121761632 CACGCCCGCACCCCTCCCGGGGG + Intronic
1103993492 12:124814649-124814671 AACTCCAGCCCCAGTCCCAGAGG + Intronic
1104064258 12:125293825-125293847 CAAGCCAGCCCCAATTCAGGGGG - Intronic
1105033006 12:132897901-132897923 CACGCCACCCCTAATCCCGCTGG + Intronic
1108526828 13:51292684-51292706 AGCCCCAGCCCCACTCCCGGAGG - Intergenic
1119266275 14:73264760-73264782 CACGCCAGGGCCAGGGCCGGGGG + Intronic
1121052404 14:90828145-90828167 CGCGCCGGCCCCAGTCCCCATGG - Intergenic
1121107806 14:91292529-91292551 CACGCCAGCCCTAGACACGTAGG + Intronic
1121328873 14:93037117-93037139 CAGGCCAGTCCCAATCCCTGGGG + Intronic
1121796706 14:96741768-96741790 CACGCCCGCCTCCGTCTCGGAGG - Intergenic
1122372296 14:101235435-101235457 CACTCCAGCCCCAGGCCCTTGGG - Intergenic
1122771447 14:104099688-104099710 CACGCCAGCACCCCTCCCTGAGG + Intronic
1122971045 14:105152371-105152393 CACGCCACACCCAGGGCCGGCGG + Intronic
1123133485 14:106007012-106007034 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123135870 14:106026985-106027007 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123165228 14:106319690-106319712 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123583506 15:21737458-21737480 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123620156 15:22180061-22180083 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1124707524 15:31977942-31977964 GGCGCCAGCCCCAGCCCTGGAGG - Intergenic
1125918567 15:43510762-43510784 CACGCCCTCCCCAGTACCAGCGG - Intergenic
1126602471 15:50442709-50442731 CACTCCAGCTCCAGCCCAGGTGG + Intronic
1128108502 15:65061473-65061495 CACTCCTGCCCCAGCCCCTGAGG - Intronic
1128995022 15:72289345-72289367 CAGGCGCGCCCCAGTCCCTGGGG + Intronic
1129682465 15:77665562-77665584 CAGGCCAGCCCAAGCCCAGGTGG + Intronic
1131352917 15:91717960-91717982 CACAGCAGCCCAAGTCCCTGAGG - Intergenic
1131493529 15:92882941-92882963 CGCGGCAGCCCCACTCCCGCGGG - Intergenic
1132697951 16:1210258-1210280 CACTTCAGCCCCGGTCCCTGCGG - Intronic
1132808384 16:1786340-1786362 CCCTGCAGCCCCAGACCCGGGGG - Intronic
1133188992 16:4119505-4119527 CACCACAGCCCCAGTCCCCCGGG - Intergenic
1133333615 16:4991906-4991928 GACGCCTGCCCCAGTCCGTGAGG + Exonic
1133403660 16:5506619-5506641 CAGGCCAGCCCCACTGCCTGGGG - Intergenic
1136686103 16:31995862-31995884 CACGTAAGCCCCTGTTCCGGGGG + Intergenic
1136786716 16:32939391-32939413 CACGTAAGCCCCTGTTCCGGGGG + Intergenic
1136883056 16:33914399-33914421 CACGTAAGCCCCTGTTCCGGGGG - Intergenic
1137237541 16:46627856-46627878 CACGCCAACCCCAGACCTGCTGG + Intergenic
1137596274 16:49726085-49726107 CATGCCAGCCCAGGTCCCCGGGG - Intronic
1140905032 16:79402562-79402584 CACGCCAGCCCTGCTCCTGGAGG - Intergenic
1141659024 16:85431693-85431715 CAGGCCAGCTCCTGTCCAGGTGG - Intergenic
1141838721 16:86560215-86560237 GGCGCCAGCCCTAGTCCCAGTGG + Intergenic
1141963751 16:87426995-87427017 CACGCGAGCCCGCGTCCCGTCGG - Intronic
1142097057 16:88245893-88245915 TGCTCCAGCCCCAGTCCCTGTGG - Intergenic
1142177346 16:88651218-88651240 CCCGGCAGCCCCAGCCCAGGCGG + Intergenic
1142247953 16:88978408-88978430 CCCTCCAGCCTCAGTCCTGGGGG - Intergenic
1142346499 16:89557461-89557483 CACGACCGCCCCAGTTCCTGTGG + Exonic
1203088952 16_KI270728v1_random:1201061-1201083 CACGTAAGCCCCTGTTCCGGGGG + Intergenic
1143387983 17:6543420-6543442 CAAGGCAGCCCCAGCCCCAGGGG + Intronic
1143452525 17:7044049-7044071 CACACAACCCCCAGGCCCGGGGG + Intergenic
1144789855 17:17851425-17851447 CAGGGCAGCACCAGCCCCGGGGG + Intronic
1145390827 17:22454279-22454301 CACGCCAGTCGGAGTCCGGGCGG + Intergenic
1146183362 17:30710378-30710400 CAAGCCGGCCGCAGTCCGGGGGG + Intergenic
1146433649 17:32822616-32822638 CCCGCCGGCCCCCGTCCCGGGGG + Intronic
1146790979 17:35750377-35750399 CCCGCTAGCCCCTGCCCCGGAGG - Intronic
1147147064 17:38491530-38491552 CACGTAAGCCCCTGTTCCGGGGG + Exonic
1147159325 17:38561421-38561443 CCCCCCACCCCCAGTCCCTGAGG + Intronic
1148157702 17:45432915-45432937 CAGCCCAGCCCCAGTCCGGGAGG - Intronic
1148456393 17:47813755-47813777 CACGTCAGCCCCAGGCCCGCTGG + Exonic
1148471482 17:47896391-47896413 GACGCCAGACCCAGCCCCAGGGG - Intronic
1150389375 17:64781597-64781619 CAGCCCAGCCCCAGTCCGGGAGG - Intergenic
1151805955 17:76405474-76405496 CACCCCAGCCCCGGGCCTGGGGG - Intronic
1152340663 17:79722369-79722391 CAGGCCAGCCCCTGGCCCAGAGG + Intergenic
1152389258 17:79992998-79993020 CAGGCCAACACCAGTCCCAGCGG + Intronic
1153676452 18:7460010-7460032 CACGGCAGCCCCCGACCTGGGGG + Intergenic
1155248728 18:23935887-23935909 CACTCCAGACCCAGTTCCTGGGG - Intronic
1160790676 19:921853-921875 CCCGCCGGCCGCAGTCCCGCAGG + Intergenic
1161119370 19:2516943-2516965 CACCCCAGCCCCAGCCCTGCTGG - Intronic
1161499684 19:4607066-4607088 AGCGCGTGCCCCAGTCCCGGGGG + Intergenic
1163435837 19:17294568-17294590 GATGCCAGCCCTAGTCCCAGCGG + Intronic
1163786600 19:19277906-19277928 CACCACAGCCCCAGCCCTGGTGG - Intronic
1165215052 19:34265208-34265230 CACCCCACCCCCGGTCCCCGAGG + Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166062888 19:40337802-40337824 CTCGCCAGCCTCAGTCCCCAAGG - Intronic
1167134422 19:47608659-47608681 GCCCCCAGCCCCAGTCCCGGGGG - Intronic
1167414354 19:49362372-49362394 CTCCCCAGCCCCAGGCCGGGAGG - Intronic
1167866982 19:52336651-52336673 CGCCGCAGCCCCAGTCCCGGCGG + Intronic
925022768 2:584940-584962 CAGGCCAGCACCAGGCCCTGTGG + Intergenic
925526668 2:4810567-4810589 CACACCAGCCCCAGGCGGGGTGG - Intergenic
929061178 2:37925649-37925671 CACGGAAGCCCTAGCCCCGGAGG + Intronic
931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG + Intergenic
932313836 2:70767160-70767182 GAGGCCATCCCCGGTCCCGGAGG - Intronic
932526582 2:72475968-72475990 CACCTCAGCCCCAGTACCAGTGG + Intronic
935609567 2:105006953-105006975 CACGCCAGGCAGAGTCCAGGAGG - Intergenic
937717829 2:125054712-125054734 CACTCCATCCCCAGTCCCACAGG - Intergenic
938140642 2:128791864-128791886 CCTGCCAGCCCCAGACCCTGCGG + Intergenic
947444980 2:230156592-230156614 GACCCCAGCTCCAGTCCAGGAGG + Intergenic
948166595 2:235867408-235867430 CTTGCCGGCCCCAGTCCCGTAGG + Intronic
948459823 2:238123734-238123756 CCGCCCAGCCCCAGCCCCGGAGG - Intronic
948980470 2:241491918-241491940 CACACCAGCTCCAGGCCCTGAGG - Intronic
1169045956 20:2534694-2534716 CAGGGCCGCCCCAGTCCCCGGGG - Intergenic
1169598261 20:7226100-7226122 CAGGCCAGCCCCAGTACCCCAGG + Intergenic
1172525915 20:35600621-35600643 GACGCCAGCCCCGGTGCCGAGGG - Intergenic
1172541108 20:35717813-35717835 CACTCCAGCCTCAGTCACAGAGG + Intronic
1172786431 20:37471917-37471939 CAAAACAGCCCCAGTCCCTGAGG + Intergenic
1172997821 20:39083848-39083870 CGCCCCAGCCCCAACCCCGGGGG + Intergenic
1173556718 20:43971411-43971433 GATGCCAGCCCCAGCCCCTGTGG - Intronic
1174403811 20:50291141-50291163 CACCCCAGCCCCAGCCCCCTTGG - Intergenic
1175368626 20:58471857-58471879 CACTCCAGCCCCAGGCTGGGTGG - Intronic
1175407891 20:58746562-58746584 GACGCCAGCCCCAGAGCAGGGGG - Intergenic
1175985104 20:62760714-62760736 GAGTCCAGCCCCAGTCCCGCAGG + Exonic
1176150112 20:63586421-63586443 CCCTCCAGCCACCGTCCCGGAGG + Intergenic
1176171627 20:63698940-63698962 CAGGCCAGCCCTAGTCGCCGGGG + Exonic
1176414522 21:6467208-6467230 CACCCCAGCCCCCGCGCCGGCGG - Intergenic
1176550593 21:8219229-8219251 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1176569523 21:8402270-8402292 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1176577435 21:8446499-8446521 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1178181579 21:30168038-30168060 CACGCCAACCACACTCCAGGTGG + Intergenic
1179504843 21:41833444-41833466 CACGCCTTCCCCATTCCCAGTGG - Intronic
1179615607 21:42581162-42581184 CCCGCCAATCCCAGTGCCGGTGG - Exonic
1179690020 21:43075530-43075552 CACCCCAGCCCCCGCGCCGGCGG - Intronic
1180099587 21:45578293-45578315 CACACCAGCCCCAGTCCCCCAGG - Intergenic
1181085153 22:20436472-20436494 CAGGCCGGCCCCCGCCCCGGAGG + Intronic
1181853155 22:25764464-25764486 CAAGCCAGCACCAGGCCCTGAGG - Intronic
1182545468 22:31073280-31073302 CACGCCAGCCCCACAACAGGAGG + Intronic
1184144661 22:42602406-42602428 CACTCCACCCCCAGGCCCAGTGG - Intronic
1184676853 22:46048051-46048073 CAAGGCAGCCACTGTCCCGGGGG + Intergenic
1184713509 22:46267570-46267592 CACACCAGCCCCAGTCCAATGGG - Intergenic
1185021717 22:48380373-48380395 CAGGCCAGACCCAGAGCCGGGGG - Intergenic
1185038197 22:48490340-48490362 CGCGCCCGCGCCAGTCCCGCCGG - Intronic
1203255492 22_KI270733v1_random:135572-135594 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
949161686 3:891224-891246 CACGCCACCCCCAATCCCGCTGG - Intergenic
949827841 3:8182165-8182187 CACGCCACCCCTAATCCCGCTGG + Intergenic
950529570 3:13545453-13545475 CACCCCAGGCCCAGGCCCGAGGG - Intergenic
950660964 3:14466799-14466821 CACACCCGCCACAGGCCCGGTGG - Intronic
952299611 3:32092852-32092874 CACTGCAGCCTCAATCCCGGGGG + Intergenic
953006022 3:38980039-38980061 CACACCAGCACCAGGCCCAGGGG + Intergenic
954121926 3:48504539-48504561 CCTCCCAGCCGCAGTCCCGGCGG + Intronic
954610359 3:51941805-51941827 CGCGCCAGCCCCGGCCCCAGAGG + Exonic
960906100 3:122603170-122603192 CAGGCCAGCACCACTCCTGGTGG + Intronic
961408929 3:126704410-126704432 CACGCCCGCCCCGGCCCAGGCGG - Intronic
961451393 3:127003881-127003903 CAGGCCAGCCACAGGCCCTGTGG - Intronic
966362789 3:179148410-179148432 GGCCCCAGCCCCAGTCCCAGCGG - Intronic
966797616 3:183730552-183730574 CACCCCACCCCCAGGCCCAGTGG - Intronic
967186459 3:186948692-186948714 CCAGCCAGCCTCAGTTCCGGAGG + Intronic
967970943 3:194999136-194999158 CAGCCCAGCCCCAGCCCCAGAGG + Intergenic
968047151 3:195630888-195630910 CAGCCCAGGCCCAGTCCAGGAGG + Intergenic
968307496 3:197659156-197659178 CAGCCCAGGCCCAGTCCAGGAGG - Intergenic
968620962 4:1603329-1603351 CAGGCCAGCCACAGTCCCTGAGG + Intergenic
968811282 4:2800678-2800700 CACCACAGCCCCAGACCCGTGGG - Intronic
969272251 4:6110900-6110922 AGCCCCAGCCCCAGCCCCGGAGG + Intronic
976739344 4:88342639-88342661 CACGCCAACCCTAATCCCGCTGG + Intergenic
977693797 4:99946300-99946322 AGCCCCAGCCCCAGGCCCGGTGG - Intronic
981040650 4:140218653-140218675 CACGCCACCCCTAATCCCGCTGG + Intergenic
981708309 4:147684124-147684146 CTCGCCAACCCCAGCCCAGGCGG + Exonic
982157232 4:152535291-152535313 CTCCCCCGCCCCAGTCCCGAGGG - Exonic
983863235 4:172734391-172734413 CACTGCAGCCCCAGGCCCAGTGG + Intronic
985744453 5:1638245-1638267 CAGCCCAGGCCCAGTCCAGGAGG - Intergenic
985868619 5:2536361-2536383 CCCTCCAGCCCCAGACCCAGAGG - Intergenic
994155651 5:96500994-96501016 CACTCCACCTCCAGTCCCTGGGG - Intergenic
998208412 5:140175609-140175631 CTCGCCACACCCCGTCCCGGGGG + Intronic
999239693 5:150120339-150120361 CAAGGCAGCCCCTGTCCCTGGGG + Intronic
999240409 5:150124380-150124402 CAGGCCAGGCCCAGTCATGGAGG + Intronic
1002616485 5:180459448-180459470 CACCCCACCCCCACTCCCGTGGG + Intergenic
1003661201 6:8064161-8064183 CGCGCCAGCCCGGGACCCGGGGG + Intronic
1006764086 6:36489573-36489595 CAAGCCTGCTCCAGTCCCAGGGG + Exonic
1007240007 6:40418020-40418042 CTCCCCAGCCCCAGCCCCAGAGG + Intronic
1007461618 6:42023273-42023295 CACGTCAGCCCTAGGCTCGGGGG - Intronic
1010532823 6:76989471-76989493 CACGCCTGCCACAGTCCGTGTGG - Intergenic
1010752544 6:79631408-79631430 CACGCCAGCCCGGAGCCCGGGGG + Exonic
1014477247 6:121888750-121888772 CACGCCCGCCCCATGCCCTGTGG + Intergenic
1016657935 6:146543353-146543375 CACGCCGACCCCGGCCCCGGGGG + Intergenic
1016833371 6:148454264-148454286 CATGCCAGCCCCTGACCCAGAGG + Intronic
1018462944 6:164016578-164016600 CACGCCACCTCCAGTTCCTGTGG - Intergenic
1019290537 7:248090-248112 ATCGCCAGCCCCAGTCCCTCAGG + Intronic
1019379158 7:712305-712327 CCCGCGCGCCCCACTCCCGGCGG + Intronic
1019505523 7:1388631-1388653 CACTCCACCCCCTGTCCCGCTGG + Intergenic
1019599445 7:1873973-1873995 CACGCCAGGGTCAGTTCCGGTGG + Intronic
1020007040 7:4788629-4788651 CACGCCAGCCTTTGTCCCGATGG + Intronic
1024685272 7:51737789-51737811 CACCCCTGCCCCAGTTCCGAGGG - Intergenic
1026772863 7:73213208-73213230 CAAGCCAGCCCCACCCCCCGCGG - Intergenic
1027013725 7:74766604-74766626 CAAGCCAGCCCCACCCCCGCGGG - Intergenic
1027074313 7:75179428-75179450 CAAGCCAGCCCCACCCCCGCGGG + Intergenic
1028684240 7:93574930-93574952 CGCGCCAGCCCCAGTCGCCCCGG + Intergenic
1033977763 7:147123747-147123769 CATGCCTGGCCCAGTCCCTGAGG - Intronic
1034088211 7:148339505-148339527 GCCGGCAGCCCGAGTCCCGGCGG - Intronic
1034227893 7:149497380-149497402 CGCGGGAGCCCCAGGCCCGGTGG + Intronic
1035663620 8:1364534-1364556 CCCGCCAGCCCCAGTCCTCCAGG - Intergenic
1039554752 8:38467943-38467965 CAAGCCCGCCCCAGATCCGGGGG + Intronic
1040671022 8:49691060-49691082 GATGCCAGCACCTGTCCCGGTGG + Intergenic
1045490299 8:102663121-102663143 CCCGCCAGCCCCAGTCACGCAGG + Intergenic
1048144213 8:131824555-131824577 CACGCCACCCCTAATCCCGCTGG + Intergenic
1049238750 8:141525886-141525908 CACCCCAGCCCCAGACCTGGTGG + Intergenic
1049492280 8:142911813-142911835 CTGGCAAGCCCCAGTCCTGGAGG + Exonic
1049819239 8:144624591-144624613 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819263 8:144624693-144624715 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819289 8:144624795-144624817 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819317 8:144624897-144624919 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819331 8:144624948-144624970 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819359 8:144625050-144625072 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819373 8:144625101-144625123 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819387 8:144625152-144625174 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819401 8:144625203-144625225 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819415 8:144625254-144625276 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819429 8:144625305-144625327 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819443 8:144625356-144625378 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819457 8:144625407-144625429 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819481 8:144625509-144625531 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819495 8:144625560-144625582 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819509 8:144625611-144625633 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819521 8:144625662-144625684 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819547 8:144625764-144625786 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819561 8:144625815-144625837 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819599 8:144625968-144625990 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819613 8:144626019-144626041 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819627 8:144626070-144626092 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819639 8:144626121-144626143 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819691 8:144626325-144626347 TGCGGCAGCCCCTGTCCCGGAGG + Intergenic
1049819705 8:144626376-144626398 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819719 8:144626427-144626449 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1049819745 8:144626529-144626551 TGCGGCAGCCCCTGTCCCGGCGG + Intergenic
1053626178 9:39874164-39874186 CACTTCAGCACCAGTCGCGGTGG + Intergenic
1053878695 9:42569068-42569090 CACTTCAGCACCAGTCGCGGTGG - Intergenic
1054217710 9:62376537-62376559 CACTTCAGCACCAGTCGCGGTGG - Intergenic
1054232993 9:62532627-62532649 CACTTCAGCACCAGTCGCGGTGG + Intergenic
1054263634 9:62897673-62897695 CACTTCAGCACCAGTCGCGGTGG + Intergenic
1057263410 9:93598675-93598697 CATCCCAGCCCCAGGCCCCGTGG - Intronic
1057786470 9:98091880-98091902 CACCCTATCCCCACTCCCGGGGG + Intronic
1061014744 9:127975171-127975193 CACGCCAGGCCCAGTCCCTGGGG - Intronic
1061404391 9:130385440-130385462 CACAGCAGACCCAGCCCCGGGGG - Intronic
1061681625 9:132245302-132245324 AATGGCAGCCCCAGTCCCCGGGG + Intergenic
1061707199 9:132462214-132462236 AAAGCCAGCCCCAGTGCCTGTGG + Intronic
1062573545 9:137196253-137196275 CACTCCACCCCCACGCCCGGGGG + Intronic
1203471888 Un_GL000220v1:118707-118729 CCCGCCGGTCCCCGTCCCGGGGG + Intergenic
1188419955 X:29980697-29980719 CACGCCACCCCTAATCCCGCTGG + Intergenic
1189336146 X:40172006-40172028 CTCGCCAACCCCAGGCCCAGAGG - Intronic
1189391647 X:40581293-40581315 CAGCCCAGCCCCGGCCCCGGCGG - Intronic
1191137724 X:57083416-57083438 CATGCCAGCAGCAGTCCTGGAGG - Intergenic
1191824696 X:65352299-65352321 CACACCAGGGCCTGTCCCGGGGG + Intergenic
1194890511 X:99372355-99372377 CGGGCCAGCGCCAGTTCCGGGGG - Intergenic
1200060705 X:153482516-153482538 CTTGCCAGCCCCTGTCCTGGGGG - Intronic
1200991114 Y:9346570-9346592 CACGCCAGGCCCAGCTCCCGAGG + Intergenic
1200993772 Y:9366863-9366885 CACGCCAGGCCCAGCTCCCGAGG + Intronic
1200996435 Y:9387181-9387203 CACGCCAGGCCCAGCTCCCGAGG + Intergenic
1200998950 Y:9455736-9455758 CACGCCAGGCCCAGCTCCCGAGG + Intergenic
1201004270 Y:9496347-9496369 CACGCCAGGCCCAGCTCCCGAGG + Intergenic
1201006923 Y:9516659-9516681 CACGCCAGGCCCAGCTCCCGAGG + Intergenic
1201009577 Y:9536965-9536987 CACGCCAGGCCCAGCTCCCGAGG + Intergenic