ID: 931047259

View in Genome Browser
Species Human (GRCh38)
Location 2:58369253-58369275
Sequence AACTGTGGAAGAGGGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931047259_931047264 -2 Left 931047259 2:58369253-58369275 CCTTGTGCCCCTCTTCCACAGTT No data
Right 931047264 2:58369274-58369296 TTTTGCTCTGCCTCGTCACCTGG No data
931047259_931047270 29 Left 931047259 2:58369253-58369275 CCTTGTGCCCCTCTTCCACAGTT No data
Right 931047270 2:58369305-58369327 TTCTTCCTCTCCGCGGGTGCAGG No data
931047259_931047269 23 Left 931047259 2:58369253-58369275 CCTTGTGCCCCTCTTCCACAGTT No data
Right 931047269 2:58369299-58369321 TTCTTTTTCTTCCTCTCCGCGGG No data
931047259_931047265 -1 Left 931047259 2:58369253-58369275 CCTTGTGCCCCTCTTCCACAGTT No data
Right 931047265 2:58369275-58369297 TTTGCTCTGCCTCGTCACCTGGG No data
931047259_931047268 22 Left 931047259 2:58369253-58369275 CCTTGTGCCCCTCTTCCACAGTT No data
Right 931047268 2:58369298-58369320 CTTCTTTTTCTTCCTCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931047259 Original CRISPR AACTGTGGAAGAGGGGCACA AGG (reversed) Intergenic
No off target data available for this crispr