ID: 931047354

View in Genome Browser
Species Human (GRCh38)
Location 2:58370643-58370665
Sequence GATAGATGTTCCTCTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931047354_931047357 -9 Left 931047354 2:58370643-58370665 CCTTCAGGAGAGGAACATCTATC No data
Right 931047357 2:58370657-58370679 ACATCTATCATGAGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931047354 Original CRISPR GATAGATGTTCCTCTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr