ID: 931049407

View in Genome Browser
Species Human (GRCh38)
Location 2:58393790-58393812
Sequence AAAACCATCTGTACTGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931049407_931049411 9 Left 931049407 2:58393790-58393812 CCTGTACCAGTACAGATGGTTTT No data
Right 931049411 2:58393822-58393844 TGTTAGGATAAATCTTGTCATGG No data
931049407_931049410 -7 Left 931049407 2:58393790-58393812 CCTGTACCAGTACAGATGGTTTT No data
Right 931049410 2:58393806-58393828 TGGTTTTAGTTATTGGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931049407 Original CRISPR AAAACCATCTGTACTGGTAC AGG (reversed) Intergenic
No off target data available for this crispr