ID: 931050376

View in Genome Browser
Species Human (GRCh38)
Location 2:58407284-58407306
Sequence TTGCATTTTTAGTAGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 568943
Summary {0: 2207, 1: 104620, 2: 220101, 3: 151566, 4: 90449}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050376_931050379 -4 Left 931050376 2:58407284-58407306 CCCCGTCTCTACTAAAAATGCAA 0: 2207
1: 104620
2: 220101
3: 151566
4: 90449
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050376_931050383 27 Left 931050376 2:58407284-58407306 CCCCGTCTCTACTAAAAATGCAA 0: 2207
1: 104620
2: 220101
3: 151566
4: 90449
Right 931050383 2:58407334-58407356 TGTTATCCCAGCTACTCAGGAGG 0: 316
1: 56486
2: 148292
3: 234787
4: 204415
931050376_931050381 24 Left 931050376 2:58407284-58407306 CCCCGTCTCTACTAAAAATGCAA 0: 2207
1: 104620
2: 220101
3: 151566
4: 90449
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050376 Original CRISPR TTGCATTTTTAGTAGAGACG GGG (reversed) Intergenic
Too many off-targets to display for this crispr