ID: 931050377

View in Genome Browser
Species Human (GRCh38)
Location 2:58407285-58407307
Sequence TTTGCATTTTTAGTAGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 593007
Summary {0: 4119, 1: 171012, 2: 210672, 3: 125323, 4: 81881}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050377_931050379 -5 Left 931050377 2:58407285-58407307 CCCGTCTCTACTAAAAATGCAAA 0: 4119
1: 171012
2: 210672
3: 125323
4: 81881
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050377_931050383 26 Left 931050377 2:58407285-58407307 CCCGTCTCTACTAAAAATGCAAA 0: 4119
1: 171012
2: 210672
3: 125323
4: 81881
Right 931050383 2:58407334-58407356 TGTTATCCCAGCTACTCAGGAGG 0: 316
1: 56486
2: 148292
3: 234787
4: 204415
931050377_931050381 23 Left 931050377 2:58407285-58407307 CCCGTCTCTACTAAAAATGCAAA 0: 4119
1: 171012
2: 210672
3: 125323
4: 81881
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050377 Original CRISPR TTTGCATTTTTAGTAGAGAC GGG (reversed) Intergenic
Too many off-targets to display for this crispr