ID: 931050378

View in Genome Browser
Species Human (GRCh38)
Location 2:58407286-58407308
Sequence TTTTGCATTTTTAGTAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 466675
Summary {0: 4729, 1: 200398, 2: 140886, 3: 66420, 4: 54242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050378_931050379 -6 Left 931050378 2:58407286-58407308 CCGTCTCTACTAAAAATGCAAAA 0: 4729
1: 200398
2: 140886
3: 66420
4: 54242
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050378_931050383 25 Left 931050378 2:58407286-58407308 CCGTCTCTACTAAAAATGCAAAA 0: 4729
1: 200398
2: 140886
3: 66420
4: 54242
Right 931050383 2:58407334-58407356 TGTTATCCCAGCTACTCAGGAGG 0: 316
1: 56486
2: 148292
3: 234787
4: 204415
931050378_931050381 22 Left 931050378 2:58407286-58407308 CCGTCTCTACTAAAAATGCAAAA 0: 4729
1: 200398
2: 140886
3: 66420
4: 54242
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050378 Original CRISPR TTTTGCATTTTTAGTAGAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr