ID: 931050379

View in Genome Browser
Species Human (GRCh38)
Location 2:58407303-58407325
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050378_931050379 -6 Left 931050378 2:58407286-58407308 CCGTCTCTACTAAAAATGCAAAA 0: 4729
1: 200398
2: 140886
3: 66420
4: 54242
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050373_931050379 19 Left 931050373 2:58407261-58407283 CCAGCCTGGCCAACATGATGAAA 0: 5744
1: 98904
2: 164756
3: 173205
4: 174944
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050374_931050379 15 Left 931050374 2:58407265-58407287 CCTGGCCAACATGATGAAACCCC 0: 3922
1: 74538
2: 159174
3: 198219
4: 157032
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050375_931050379 10 Left 931050375 2:58407270-58407292 CCAACATGATGAAACCCCGTCTC 0: 1934
1: 41960
2: 132733
3: 143558
4: 92193
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050377_931050379 -5 Left 931050377 2:58407285-58407307 CCCGTCTCTACTAAAAATGCAAA 0: 4119
1: 171012
2: 210672
3: 125323
4: 81881
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data
931050376_931050379 -4 Left 931050376 2:58407284-58407306 CCCCGTCTCTACTAAAAATGCAA 0: 2207
1: 104620
2: 220101
3: 151566
4: 90449
Right 931050379 2:58407303-58407325 GCAAAATTAACCGAGCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr