ID: 931050380

View in Genome Browser
Species Human (GRCh38)
Location 2:58407313-58407335
Sequence CAGGCACATGCCGCTGTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050380_931050387 8 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050387 2:58407344-58407366 GCTACTCAGGAGGCTGAGGCAGG No data
931050380_931050388 26 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG No data
931050380_931050381 -5 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG No data
931050380_931050383 -2 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050383 2:58407334-58407356 TGTTATCCCAGCTACTCAGGAGG No data
931050380_931050385 4 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050385 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG No data
931050380_931050389 27 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050380 Original CRISPR CAGGCACATGCCGCTGTGCT CGG (reversed) Intergenic