ID: 931050380

View in Genome Browser
Species Human (GRCh38)
Location 2:58407313-58407335
Sequence CAGGCACATGCCGCTGTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050380_931050383 -2 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050383 2:58407334-58407356 TGTTATCCCAGCTACTCAGGAGG 0: 316
1: 56486
2: 148292
3: 234787
4: 204415
931050380_931050387 8 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050387 2:58407344-58407366 GCTACTCAGGAGGCTGAGGCAGG 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
931050380_931050388 26 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
931050380_931050385 4 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050385 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
931050380_931050381 -5 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740
931050380_931050389 27 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050380 Original CRISPR CAGGCACATGCCGCTGTGCT CGG (reversed) Intergenic
No off target data available for this crispr