ID: 931050381

View in Genome Browser
Species Human (GRCh38)
Location 2:58407331-58407353
Sequence GCCTGTTATCCCAGCTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 700385
Summary {0: 426, 1: 76200, 2: 213790, 3: 235229, 4: 174740}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050377_931050381 23 Left 931050377 2:58407285-58407307 CCCGTCTCTACTAAAAATGCAAA 0: 4119
1: 171012
2: 210672
3: 125323
4: 81881
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740
931050376_931050381 24 Left 931050376 2:58407284-58407306 CCCCGTCTCTACTAAAAATGCAA 0: 2207
1: 104620
2: 220101
3: 151566
4: 90449
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740
931050378_931050381 22 Left 931050378 2:58407286-58407308 CCGTCTCTACTAAAAATGCAAAA 0: 4729
1: 200398
2: 140886
3: 66420
4: 54242
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740
931050380_931050381 -5 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050381 2:58407331-58407353 GCCTGTTATCCCAGCTACTCAGG 0: 426
1: 76200
2: 213790
3: 235229
4: 174740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050381 Original CRISPR GCCTGTTATCCCAGCTACTC AGG Intergenic
Too many off-targets to display for this crispr