ID: 931050382

View in Genome Browser
Species Human (GRCh38)
Location 2:58407332-58407354
Sequence TCCTGAGTAGCTGGGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 643012
Summary {0: 310, 1: 56158, 2: 148024, 3: 234292, 4: 204228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050382_931050389 8 Left 931050382 2:58407332-58407354 CCTGTTATCCCAGCTACTCAGGA 0: 310
1: 56158
2: 148024
3: 234292
4: 204228
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
931050382_931050391 17 Left 931050382 2:58407332-58407354 CCTGTTATCCCAGCTACTCAGGA 0: 310
1: 56158
2: 148024
3: 234292
4: 204228
Right 931050391 2:58407372-58407394 CGCTTGAACCTGGGAGATGGAGG 0: 549
1: 9064
2: 38873
3: 85995
4: 132612
931050382_931050390 14 Left 931050382 2:58407332-58407354 CCTGTTATCCCAGCTACTCAGGA 0: 310
1: 56158
2: 148024
3: 234292
4: 204228
Right 931050390 2:58407369-58407391 AATCGCTTGAACCTGGGAGATGG 0: 1081
1: 19355
2: 63501
3: 100588
4: 122481
931050382_931050388 7 Left 931050382 2:58407332-58407354 CCTGTTATCCCAGCTACTCAGGA 0: 310
1: 56158
2: 148024
3: 234292
4: 204228
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050382 Original CRISPR TCCTGAGTAGCTGGGATAAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr