ID: 931050384

View in Genome Browser
Species Human (GRCh38)
Location 2:58407340-58407362
Sequence CCTCAGCCTCCTGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 777919
Summary {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050384_931050391 9 Left 931050384 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 931050391 2:58407372-58407394 CGCTTGAACCTGGGAGATGGAGG 0: 549
1: 9064
2: 38873
3: 85995
4: 132612
931050384_931050388 -1 Left 931050384 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
931050384_931050389 0 Left 931050384 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
931050384_931050390 6 Left 931050384 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 931050390 2:58407369-58407391 AATCGCTTGAACCTGGGAGATGG 0: 1081
1: 19355
2: 63501
3: 100588
4: 122481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050384 Original CRISPR CCTCAGCCTCCTGAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr