ID: 931050385

View in Genome Browser
Species Human (GRCh38)
Location 2:58407340-58407362
Sequence CCCAGCTACTCAGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 775197
Summary {0: 92886, 1: 198857, 2: 236674, 3: 157910, 4: 88870}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050380_931050385 4 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050385 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050385 Original CRISPR CCCAGCTACTCAGGAGGCTG AGG Intergenic
Too many off-targets to display for this crispr