ID: 931050386

View in Genome Browser
Species Human (GRCh38)
Location 2:58407341-58407363
Sequence GCCTCAGCCTCCTGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 757156
Summary {0: 84870, 1: 190808, 2: 228673, 3: 158767, 4: 94038}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050386_931050389 -1 Left 931050386 2:58407341-58407363 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
931050386_931050391 8 Left 931050386 2:58407341-58407363 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 931050391 2:58407372-58407394 CGCTTGAACCTGGGAGATGGAGG 0: 549
1: 9064
2: 38873
3: 85995
4: 132612
931050386_931050388 -2 Left 931050386 2:58407341-58407363 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
931050386_931050390 5 Left 931050386 2:58407341-58407363 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 931050390 2:58407369-58407391 AATCGCTTGAACCTGGGAGATGG 0: 1081
1: 19355
2: 63501
3: 100588
4: 122481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050386 Original CRISPR GCCTCAGCCTCCTGAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr