ID: 931050387

View in Genome Browser
Species Human (GRCh38)
Location 2:58407344-58407366
Sequence GCTACTCAGGAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701844
Summary {0: 77881, 1: 176222, 2: 210480, 3: 146546, 4: 90715}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050380_931050387 8 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050387 2:58407344-58407366 GCTACTCAGGAGGCTGAGGCAGG 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050387 Original CRISPR GCTACTCAGGAGGCTGAGGC AGG Intergenic
Too many off-targets to display for this crispr