ID: 931050388

View in Genome Browser
Species Human (GRCh38)
Location 2:58407362-58407384
Sequence GCAGGAGAATCGCTTGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432789
Summary {0: 41236, 1: 112059, 2: 146946, 3: 86404, 4: 46144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050384_931050388 -1 Left 931050384 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
931050382_931050388 7 Left 931050382 2:58407332-58407354 CCTGTTATCCCAGCTACTCAGGA 0: 310
1: 56158
2: 148024
3: 234292
4: 204228
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
931050380_931050388 26 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
931050386_931050388 -2 Left 931050386 2:58407341-58407363 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 931050388 2:58407362-58407384 GCAGGAGAATCGCTTGAACCTGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050388 Original CRISPR GCAGGAGAATCGCTTGAACC TGG Intergenic
Too many off-targets to display for this crispr