ID: 931050389

View in Genome Browser
Species Human (GRCh38)
Location 2:58407363-58407385
Sequence CAGGAGAATCGCTTGAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 633736
Summary {0: 22579, 1: 106059, 2: 182600, 3: 191733, 4: 130765}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050382_931050389 8 Left 931050382 2:58407332-58407354 CCTGTTATCCCAGCTACTCAGGA 0: 310
1: 56158
2: 148024
3: 234292
4: 204228
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
931050380_931050389 27 Left 931050380 2:58407313-58407335 CCGAGCACAGCGGCATGTGCCTG No data
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
931050384_931050389 0 Left 931050384 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765
931050386_931050389 -1 Left 931050386 2:58407341-58407363 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 931050389 2:58407363-58407385 CAGGAGAATCGCTTGAACCTGGG 0: 22579
1: 106059
2: 182600
3: 191733
4: 130765

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050389 Original CRISPR CAGGAGAATCGCTTGAACCT GGG Intergenic
Too many off-targets to display for this crispr