ID: 931050390

View in Genome Browser
Species Human (GRCh38)
Location 2:58407369-58407391
Sequence AATCGCTTGAACCTGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307006
Summary {0: 1081, 1: 19355, 2: 63501, 3: 100588, 4: 122481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931050382_931050390 14 Left 931050382 2:58407332-58407354 CCTGTTATCCCAGCTACTCAGGA 0: 310
1: 56158
2: 148024
3: 234292
4: 204228
Right 931050390 2:58407369-58407391 AATCGCTTGAACCTGGGAGATGG 0: 1081
1: 19355
2: 63501
3: 100588
4: 122481
931050384_931050390 6 Left 931050384 2:58407340-58407362 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 931050390 2:58407369-58407391 AATCGCTTGAACCTGGGAGATGG 0: 1081
1: 19355
2: 63501
3: 100588
4: 122481
931050386_931050390 5 Left 931050386 2:58407341-58407363 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 931050390 2:58407369-58407391 AATCGCTTGAACCTGGGAGATGG 0: 1081
1: 19355
2: 63501
3: 100588
4: 122481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931050390 Original CRISPR AATCGCTTGAACCTGGGAGA TGG Intergenic
Too many off-targets to display for this crispr