ID: 931053572

View in Genome Browser
Species Human (GRCh38)
Location 2:58441653-58441675
Sequence TGGTGGTCCCAGGACTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931053566_931053572 11 Left 931053566 2:58441619-58441641 CCTCTCTGAGTTGTTTGCTTGGA No data
Right 931053572 2:58441653-58441675 TGGTGGTCCCAGGACTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931053572 Original CRISPR TGGTGGTCCCAGGACTCCCA AGG Intergenic
No off target data available for this crispr