ID: 931057005

View in Genome Browser
Species Human (GRCh38)
Location 2:58483500-58483522
Sequence CAGTGAGGGCCTGGAGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931057005_931057014 20 Left 931057005 2:58483500-58483522 CCCTATCCTCCAGGCCCTCACTG No data
Right 931057014 2:58483543-58483565 CACGGAGCTCAACTTAGTTTTGG No data
931057005_931057015 21 Left 931057005 2:58483500-58483522 CCCTATCCTCCAGGCCCTCACTG No data
Right 931057015 2:58483544-58483566 ACGGAGCTCAACTTAGTTTTGGG No data
931057005_931057011 2 Left 931057005 2:58483500-58483522 CCCTATCCTCCAGGCCCTCACTG No data
Right 931057011 2:58483525-58483547 TTCCATGCATACCTCTATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931057005 Original CRISPR CAGTGAGGGCCTGGAGGATA GGG (reversed) Intergenic
No off target data available for this crispr