ID: 931057923

View in Genome Browser
Species Human (GRCh38)
Location 2:58493612-58493634
Sequence CAGTATCTGATATGAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931057923_931057927 -4 Left 931057923 2:58493612-58493634 CCAGACACTCATATCAGATACTG No data
Right 931057927 2:58493631-58493653 ACTGCCCTGGAGAAGGTCAAGGG No data
931057923_931057926 -5 Left 931057923 2:58493612-58493634 CCAGACACTCATATCAGATACTG No data
Right 931057926 2:58493630-58493652 TACTGCCCTGGAGAAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931057923 Original CRISPR CAGTATCTGATATGAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr