ID: 931058297

View in Genome Browser
Species Human (GRCh38)
Location 2:58497738-58497760
Sequence TCTCCCCGCTTTTAAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931058293_931058297 9 Left 931058293 2:58497706-58497728 CCTCGAACTATCCTTTTGCTTTA No data
Right 931058297 2:58497738-58497760 TCTCCCCGCTTTTAAAGAACAGG No data
931058295_931058297 -2 Left 931058295 2:58497717-58497739 CCTTTTGCTTTAATCAGGCCTTC No data
Right 931058297 2:58497738-58497760 TCTCCCCGCTTTTAAAGAACAGG No data
931058292_931058297 12 Left 931058292 2:58497703-58497725 CCACCTCGAACTATCCTTTTGCT No data
Right 931058297 2:58497738-58497760 TCTCCCCGCTTTTAAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931058297 Original CRISPR TCTCCCCGCTTTTAAAGAAC AGG Intergenic
No off target data available for this crispr