ID: 931061087

View in Genome Browser
Species Human (GRCh38)
Location 2:58530663-58530685
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931061081_931061087 -8 Left 931061081 2:58530648-58530670 CCTATAATCCCAGCACTTTGGAA 0: 1158
1: 38766
2: 329426
3: 249898
4: 134520
Right 931061087 2:58530663-58530685 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931061087 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr