ID: 931065191

View in Genome Browser
Species Human (GRCh38)
Location 2:58578264-58578286
Sequence CAGATCATGCTGGACCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931065185_931065191 14 Left 931065185 2:58578227-58578249 CCAGAGGAAGAAAAAGTCAGGGA No data
Right 931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931065191 Original CRISPR CAGATCATGCTGGACCTTGT GGG Intergenic
No off target data available for this crispr