ID: 931067831

View in Genome Browser
Species Human (GRCh38)
Location 2:58606790-58606812
Sequence CTGTGGAAAAGCAGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931067826_931067831 8 Left 931067826 2:58606759-58606781 CCAAAAGGTAGGAGAGAAAAGGA No data
Right 931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931067831 Original CRISPR CTGTGGAAAAGCAGAGGGGA AGG Intergenic
No off target data available for this crispr