ID: 931071868

View in Genome Browser
Species Human (GRCh38)
Location 2:58660539-58660561
Sequence TACAGCACTTTGAGAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931071862_931071868 0 Left 931071862 2:58660516-58660538 CCAGGCGCAATGGCCCAGGCCCA No data
Right 931071868 2:58660539-58660561 TACAGCACTTTGAGAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931071868 Original CRISPR TACAGCACTTTGAGAGGCAG AGG Intergenic
No off target data available for this crispr