ID: 931072532

View in Genome Browser
Species Human (GRCh38)
Location 2:58669299-58669321
Sequence TCACCATTTCATTTTACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931072532_931072534 10 Left 931072532 2:58669299-58669321 CCTCCAGTAAAATGAAATGGTGA No data
Right 931072534 2:58669332-58669354 TTCTGTCTTATTTCCAATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931072532 Original CRISPR TCACCATTTCATTTTACTGG AGG (reversed) Intergenic
No off target data available for this crispr