ID: 931073833

View in Genome Browser
Species Human (GRCh38)
Location 2:58686507-58686529
Sequence ATGCTTGGATTTAGGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931073829_931073833 9 Left 931073829 2:58686475-58686497 CCTTTGTGCAGTGAACTACTTTT No data
Right 931073833 2:58686507-58686529 ATGCTTGGATTTAGGAAAATAGG No data
931073827_931073833 14 Left 931073827 2:58686470-58686492 CCCTACCTTTGTGCAGTGAACTA No data
Right 931073833 2:58686507-58686529 ATGCTTGGATTTAGGAAAATAGG No data
931073828_931073833 13 Left 931073828 2:58686471-58686493 CCTACCTTTGTGCAGTGAACTAC No data
Right 931073833 2:58686507-58686529 ATGCTTGGATTTAGGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931073833 Original CRISPR ATGCTTGGATTTAGGAAAAT AGG Intergenic
No off target data available for this crispr