ID: 931077208

View in Genome Browser
Species Human (GRCh38)
Location 2:58729029-58729051
Sequence CAGGTTAAGCATACAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931077208_931077211 25 Left 931077208 2:58729029-58729051 CCAGAACCTGTATGCTTAACCTG No data
Right 931077211 2:58729077-58729099 AAAAATGATATTCATAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931077208 Original CRISPR CAGGTTAAGCATACAGGTTC TGG (reversed) Intergenic
No off target data available for this crispr