ID: 931077211

View in Genome Browser
Species Human (GRCh38)
Location 2:58729077-58729099
Sequence AAAAATGATATTCATAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931077209_931077211 19 Left 931077209 2:58729035-58729057 CCTGTATGCTTAACCTGTATGTT No data
Right 931077211 2:58729077-58729099 AAAAATGATATTCATAATTGTGG No data
931077208_931077211 25 Left 931077208 2:58729029-58729051 CCAGAACCTGTATGCTTAACCTG No data
Right 931077211 2:58729077-58729099 AAAAATGATATTCATAATTGTGG No data
931077210_931077211 6 Left 931077210 2:58729048-58729070 CCTGTATGTTTATATAAAGCAGA No data
Right 931077211 2:58729077-58729099 AAAAATGATATTCATAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931077211 Original CRISPR AAAAATGATATTCATAATTG TGG Intergenic
No off target data available for this crispr