ID: 931078982

View in Genome Browser
Species Human (GRCh38)
Location 2:58747669-58747691
Sequence CATGTTCACTAGACAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931078979_931078982 29 Left 931078979 2:58747617-58747639 CCTTAATTTTTTACAAATCTATA No data
Right 931078982 2:58747669-58747691 CATGTTCACTAGACAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931078982 Original CRISPR CATGTTCACTAGACAGATTA TGG Intergenic
No off target data available for this crispr