ID: 931082276

View in Genome Browser
Species Human (GRCh38)
Location 2:58787676-58787698
Sequence AACTAGAACTTTAAGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931082276_931082277 -9 Left 931082276 2:58787676-58787698 CCTTCTTACTTAAAGTTCTAGTT No data
Right 931082277 2:58787690-58787712 GTTCTAGTTCATGACTGATTTGG No data
931082276_931082278 0 Left 931082276 2:58787676-58787698 CCTTCTTACTTAAAGTTCTAGTT No data
Right 931082278 2:58787699-58787721 CATGACTGATTTGGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931082276 Original CRISPR AACTAGAACTTTAAGTAAGA AGG (reversed) Intergenic
No off target data available for this crispr