ID: 931082340

View in Genome Browser
Species Human (GRCh38)
Location 2:58788517-58788539
Sequence CAGCATAAGGGGAAGGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931082335_931082340 6 Left 931082335 2:58788488-58788510 CCTATGCTTGTCACTAGTGGGTG No data
Right 931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG No data
931082332_931082340 17 Left 931082332 2:58788477-58788499 CCTAGAATTTGCCTATGCTTGTC No data
Right 931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG No data
931082331_931082340 18 Left 931082331 2:58788476-58788498 CCCTAGAATTTGCCTATGCTTGT No data
Right 931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG No data
931082330_931082340 21 Left 931082330 2:58788473-58788495 CCTCCCTAGAATTTGCCTATGCT No data
Right 931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931082340 Original CRISPR CAGCATAAGGGGAAGGATAC AGG Intergenic
No off target data available for this crispr