ID: 931083039

View in Genome Browser
Species Human (GRCh38)
Location 2:58797056-58797078
Sequence CTCAGTTTACTCACAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931083036_931083039 17 Left 931083036 2:58797016-58797038 CCTATCTCTAAACATCAATCTTG No data
Right 931083039 2:58797056-58797078 CTCAGTTTACTCACAGAAGCAGG No data
931083034_931083039 28 Left 931083034 2:58797005-58797027 CCAGTTCCAAGCCTATCTCTAAA No data
Right 931083039 2:58797056-58797078 CTCAGTTTACTCACAGAAGCAGG No data
931083035_931083039 22 Left 931083035 2:58797011-58797033 CCAAGCCTATCTCTAAACATCAA No data
Right 931083039 2:58797056-58797078 CTCAGTTTACTCACAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931083039 Original CRISPR CTCAGTTTACTCACAGAAGC AGG Intergenic
No off target data available for this crispr