ID: 931088678

View in Genome Browser
Species Human (GRCh38)
Location 2:58862791-58862813
Sequence TTAAGTCATGTGGAGAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931088674_931088678 12 Left 931088674 2:58862756-58862778 CCTATCGGACAGAATTATTGTGA No data
Right 931088678 2:58862791-58862813 TTAAGTCATGTGGAGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931088678 Original CRISPR TTAAGTCATGTGGAGAACCT GGG Intergenic
No off target data available for this crispr