ID: 931092053

View in Genome Browser
Species Human (GRCh38)
Location 2:58896704-58896726
Sequence GTGTGGGTGTGGAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931092053_931092062 22 Left 931092053 2:58896704-58896726 CCCATTTCCCTCCACACCCACAC No data
Right 931092062 2:58896749-58896771 AGCAAAAGCCACGAACTAGTGGG No data
931092053_931092061 21 Left 931092053 2:58896704-58896726 CCCATTTCCCTCCACACCCACAC No data
Right 931092061 2:58896748-58896770 CAGCAAAAGCCACGAACTAGTGG No data
931092053_931092063 29 Left 931092053 2:58896704-58896726 CCCATTTCCCTCCACACCCACAC No data
Right 931092063 2:58896756-58896778 GCCACGAACTAGTGGGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931092053 Original CRISPR GTGTGGGTGTGGAGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr