ID: 931093823

View in Genome Browser
Species Human (GRCh38)
Location 2:58917298-58917320
Sequence AAGGCTAAACACCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931093823_931093828 26 Left 931093823 2:58917298-58917320 CCATCCTCCTGGTGTTTAGCCTT No data
Right 931093828 2:58917347-58917369 TTATAGAGAATTATGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931093823 Original CRISPR AAGGCTAAACACCAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr