ID: 931096247

View in Genome Browser
Species Human (GRCh38)
Location 2:58943844-58943866
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931096247_931096251 0 Left 931096247 2:58943844-58943866 CCCTTCCCTCTCTACTTCTCTCT No data
Right 931096251 2:58943867-58943889 CTCCTGCCACCACATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931096247 Original CRISPR AGAGAGAAGTAGAGAGGGAA GGG (reversed) Intergenic
No off target data available for this crispr