ID: 931098586

View in Genome Browser
Species Human (GRCh38)
Location 2:58970241-58970263
Sequence TCCCTCTAATTACTAGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931098586_931098589 20 Left 931098586 2:58970241-58970263 CCCCACTCTAGTAATTAGAGGGA No data
Right 931098589 2:58970284-58970306 TAATACTTGAGAGTCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931098586 Original CRISPR TCCCTCTAATTACTAGAGTG GGG (reversed) Intergenic
No off target data available for this crispr