ID: 931098589

View in Genome Browser
Species Human (GRCh38)
Location 2:58970284-58970306
Sequence TAATACTTGAGAGTCAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931098586_931098589 20 Left 931098586 2:58970241-58970263 CCCCACTCTAGTAATTAGAGGGA No data
Right 931098589 2:58970284-58970306 TAATACTTGAGAGTCAAAATTGG No data
931098588_931098589 18 Left 931098588 2:58970243-58970265 CCACTCTAGTAATTAGAGGGATA No data
Right 931098589 2:58970284-58970306 TAATACTTGAGAGTCAAAATTGG No data
931098587_931098589 19 Left 931098587 2:58970242-58970264 CCCACTCTAGTAATTAGAGGGAT No data
Right 931098589 2:58970284-58970306 TAATACTTGAGAGTCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931098589 Original CRISPR TAATACTTGAGAGTCAAAAT TGG Intergenic
No off target data available for this crispr