ID: 931098979

View in Genome Browser
Species Human (GRCh38)
Location 2:58974043-58974065
Sequence CAGAGCAAGGTGAAGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931098971_931098979 -5 Left 931098971 2:58974025-58974047 CCCCCTCTCCCTGGGTCTCAGAG No data
Right 931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG No data
931098974_931098979 -8 Left 931098974 2:58974028-58974050 CCTCTCCCTGGGTCTCAGAGCAA No data
Right 931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG No data
931098972_931098979 -6 Left 931098972 2:58974026-58974048 CCCCTCTCCCTGGGTCTCAGAGC No data
Right 931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG No data
931098973_931098979 -7 Left 931098973 2:58974027-58974049 CCCTCTCCCTGGGTCTCAGAGCA No data
Right 931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931098979 Original CRISPR CAGAGCAAGGTGAAGGTGTC TGG Intergenic
No off target data available for this crispr