ID: 931102309

View in Genome Browser
Species Human (GRCh38)
Location 2:59015756-59015778
Sequence GGGACCTGCCCTATCTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931102305_931102309 4 Left 931102305 2:59015729-59015751 CCTTGGCTTGAAGGTGGGATTTT No data
Right 931102309 2:59015756-59015778 GGGACCTGCCCTATCTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931102309 Original CRISPR GGGACCTGCCCTATCTGCCT AGG Intergenic
No off target data available for this crispr