ID: 931104543

View in Genome Browser
Species Human (GRCh38)
Location 2:59040940-59040962
Sequence CAAAAGCCTGCATTATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931104540_931104543 14 Left 931104540 2:59040903-59040925 CCAAGTCAGATAGTCTTCTGCTG No data
Right 931104543 2:59040940-59040962 CAAAAGCCTGCATTATTTTCTGG No data
931104539_931104543 15 Left 931104539 2:59040902-59040924 CCCAAGTCAGATAGTCTTCTGCT No data
Right 931104543 2:59040940-59040962 CAAAAGCCTGCATTATTTTCTGG No data
931104538_931104543 18 Left 931104538 2:59040899-59040921 CCTCCCAAGTCAGATAGTCTTCT No data
Right 931104543 2:59040940-59040962 CAAAAGCCTGCATTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931104543 Original CRISPR CAAAAGCCTGCATTATTTTC TGG Intergenic
No off target data available for this crispr