ID: 931105762

View in Genome Browser
Species Human (GRCh38)
Location 2:59053543-59053565
Sequence GTGGAAATCCCTCCTTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931105762_931105767 3 Left 931105762 2:59053543-59053565 CCACTTAAAGGAGGGATTTCCAC No data
Right 931105767 2:59053569-59053591 AAGGAGGGATATCCACTTAAAGG No data
931105762_931105768 6 Left 931105762 2:59053543-59053565 CCACTTAAAGGAGGGATTTCCAC No data
Right 931105768 2:59053572-59053594 GAGGGATATCCACTTAAAGGAGG No data
931105762_931105769 7 Left 931105762 2:59053543-59053565 CCACTTAAAGGAGGGATTTCCAC No data
Right 931105769 2:59053573-59053595 AGGGATATCCACTTAAAGGAGGG No data
931105762_931105771 21 Left 931105762 2:59053543-59053565 CCACTTAAAGGAGGGATTTCCAC No data
Right 931105771 2:59053587-59053609 AAAGGAGGGATATCCACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931105762 Original CRISPR GTGGAAATCCCTCCTTTAAG TGG (reversed) Intergenic
No off target data available for this crispr