ID: 931105769

View in Genome Browser
Species Human (GRCh38)
Location 2:59053573-59053595
Sequence AGGGATATCCACTTAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931105762_931105769 7 Left 931105762 2:59053543-59053565 CCACTTAAAGGAGGGATTTCCAC No data
Right 931105769 2:59053573-59053595 AGGGATATCCACTTAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931105769 Original CRISPR AGGGATATCCACTTAAAGGA GGG Intergenic
No off target data available for this crispr