ID: 931107854

View in Genome Browser
Species Human (GRCh38)
Location 2:59076940-59076962
Sequence CTTCATTGCCTCAATTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931107854_931107864 20 Left 931107854 2:59076940-59076962 CCATGCTAATTGAGGCAATGAAG No data
Right 931107864 2:59076983-59077005 ACAGAGACTAGTGGTGCTCTGGG No data
931107854_931107862 11 Left 931107854 2:59076940-59076962 CCATGCTAATTGAGGCAATGAAG No data
Right 931107862 2:59076974-59076996 CAACTTTGTACAGAGACTAGTGG No data
931107854_931107863 19 Left 931107854 2:59076940-59076962 CCATGCTAATTGAGGCAATGAAG No data
Right 931107863 2:59076982-59077004 TACAGAGACTAGTGGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931107854 Original CRISPR CTTCATTGCCTCAATTAGCA TGG (reversed) Intergenic
No off target data available for this crispr